TkA05G333940 | RubberDandelionOmics

Gene overview

TkA05G333940

Reference: TK1151 Chr: Chr05 Coordinates: 82267112-82269087 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1025 bp · TkA05G333940|TK1151|cDNA

ATATTTGGCACGTTTCCGATGAAAACCCTACCATCTAAAATCAATCGGACCTCGTCTCTACCTTCTCCAACCGAAAGACTTCGCCTTTCTCCATTTCTCCACCCAACGACGTCATCCGGAGGTTGCTCCGACGACACCTTCGACGTAATTTTTGTTGATGGAAGATTCAGAAGATGTTTGTGAACGCTATAATAGCACGTGTTCCACTTCCACAACTTCCACTGGATACCGATTATTTGATCGACAGGCCACAATTCACC...

CDS

Download CDS FASTA

690 bp · TkA05G333940|TK1151|CDS

ATGGAAGATTCAGAAGATGTTTGTGAACGCTATAATAGCACGTGTTCCACTTCCACAACTTCCACTGGATACCGATTATTTGATCGACAGGCCACAATTCACCAGTTGATGGGCGGTGGAAAAGCGGCTGATGCGCTCCTATGGAAGAGGCAACACATCTCATGGGGCATCATTATTGTCGCCACTGTGGCATGGCTATTATTCGACCAATCCGGATTGTCATTCCTAACAATTTGTTCCGATGTTCTTTTGTTCTTGAT...

Protein

Download Protein FASTA

229 aa · TkA05G333940|TK1151|PROTEIN

MEDSEDVCERYNSTCSTSTTSTGYRLFDRQATIHQLMGGGKAADALLWKRQHISWGIIIVATVAWLLFDQSGLSFLTICSDVLLFLIVLCFLHATYASLTDKQIQTLPELVLSEEMVNYAATSFRMKVNHLLLMAHDITLGKDFRLFFMAVGFLWVLSVLGSLISFFTLAYIGTILSVTLPALYNRYEDQVDRCAGTIHRNVSRHYKIVDDNVMSRFPRNNVVVKDKPM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G333940`
TK1151 ID	TkA05G333940
OH-1004 ID	LXL04_000155
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	35.000
Protein coverage (%)	TK1151 86.026 / OH-1004 93.810 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G333940

Location Chr05:82267112-82269087 (+)

Description Similar to RTNLB12: Reticulon-like protein B12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10915`	Reticulon-like protein B16.	No verified direct reference in this release
`At3g54120`	Reticulon-like protein B12.	No verified direct reference in this release
`At3g19460`	Reticulon-like protein B11.	No verified direct reference in this release
`At2g15280`	Reticulon-like protein B10.	No verified direct reference in this release
`At1g68230`	Reticulon-like protein B14.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000155 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0071786 endoplasmic reticulum tubular network organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0071782 endoplasmic reticulum tubular network Cellular Component

GO:0098554 cytoplasmic side of endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT2G46170

ath:AT3G10915

ath:AT3G19460

ath:AT3G54120

ath:AT5G41600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.468

Rank 1 · TkA05G333940 · TK1151

Cell membrane0.182

Rank 2 · TkA05G333940 · TK1151

Cytoplasm0.173

Rank 3 · TkA05G333940 · TK1151

Lysosome / Vacuole0.165

Rank 4 · TkA05G333940 · TK1151

Golgi apparatus0.142

Rank 5 · TkA05G333940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02453Reticulon43-197 aa

PF24456RHD_RETREG1-344-182 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G333940	`PF02453`	Reticulon	43	197	1.4e-44	152.5
TkA05G333940	`PF24456`	RHD_RETREG1-3	44	182	1.1	9.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYH6`	Arabidopsis thaliana	sp\|Q8GYH6\|RTNLP_ARATH Reticulon-like protein B16	63.100%	Swiss-Prot	High
`Q9M392`	Arabidopsis thaliana	sp\|Q9M392\|RTNLL_ARATH Reticulon-like protein B12	37.200%	Swiss-Prot	Medium
`Q9LT71`	Arabidopsis thaliana	sp\|Q9LT71\|RTNLK_ARATH Reticulon-like protein B11	33.000%	Swiss-Prot	Medium
`Q6NPD8`	Arabidopsis thaliana	sp\|Q6NPD8\|RTNLJ_ARATH Reticulon-like protein B10	29.800%	Swiss-Prot	Low
`A2RVT6`	Arabidopsis thaliana	sp\|A2RVT6\|RTNLN_ARATH Reticulon-like protein B14	31.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card