TkA05G302030 | RubberDandelionOmics

Gene overview

TkA05G302030

Reference: TK1151 Chr: Chr05 Coordinates: 74497167-74501073 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2185 bp · TkA05G302030|TK1151|cDNA

CTAAGTCAAATAAGTGGAAATTCATGGACCATGTGGATATAAATATATACTATTGAAGAAAAGAAAATCAAAAAAGAACAGTGCGAGTGTGTTTGGGTGGTGCAGCCTTCAAGCTGCACAACCACCACTCATTTCAAAAGGAACCAAATCAAGAAATCCAAACTAAAATCCACATTCAACGACCACCACAATGTAGACTTGAAAACAATAACCTCCTTCTGCAACCACTCCTCCTCCCTACACCACCACCCTCCATGGCC...

CDS

Download CDS FASTA

1317 bp · TkA05G302030|TK1151|CDS

ATGGCTGCCTCTTCTTACTGTTTCTCTCCAACTAGAAACCCAATCACACATTCAAATTCAAGTTTCTTGTTTCTTAATTCAAATCTTTATCTACCAAAACACAGAAACCATGCTTCTTTCACTTACGAAACCAAGAAAGATCTGATTTCCAACATACCCAAATCATCAATTTCACTTCTCAACATCAAGAACCAGCATAAATCCAGACACCCTTTTGCCTCTTTATCATCTTTTGCTGAAAATCAAGAAGGTGAAGGTGA...

Protein

Download Protein FASTA

438 aa · TkA05G302030|TK1151|PROTEIN

MAASSYCFSPTRNPITHSNSSFLFLNSNLYLPKHRNHASFTYETKKDLISNIPKSSISLLNIKNQHKSRHPFASLSSFAENQEGEGENQENVKEEDELPGMAQAFHISSTTASAISICIAVAALALPLVMKSLAQGMGLKIKLLSYATLLFGFFMAWNIGANDVANAMGTSVGSGALSLRQAVLTAAVLEFSGALLMGRHVTSTMQKGILVANVFQGKDALLFAGLLSSLAAAGTWLQVASFYGWPVSTTHCIVGSMVGF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G302030`
TK1151 ID	TkA05G302030
OH-1004 ID	LXL04_020750
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.800
Protein coverage (%)	TK1151 93.607 / OH-1004 71.057 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G302030

Location Chr05:74497167-74501073 (-)

Description Similar to PHT2-1: Inorganic phosphate transporter 2-1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26570`	May act as a chloroplast low-affinity H⁺/inorganic phosphate symporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020750 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0035435 phosphate ion transmembrane transport Biological Process

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

GO:0009673 low-affinity phosphate transmembrane transporter activity Molecular Function

GO:0015293 symporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G26570

cpa:CP_0067

cpj:ygo4

cpn:CPn_0680

cpt:CpB0707

ctr:CT_692

pab:PAB0927

pho:PH0640

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · TkA05G302030 · TK1151

Mitochondrion0.033

Rank 2 · TkA05G302030 · TK1151

Nucleus0.017

Rank 3 · TkA05G302030 · TK1151

Cell membrane0.017

Rank 4 · TkA05G302030 · TK1151

Cytoplasm0.016

Rank 5 · TkA05G302030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20237DUF659434-162 aa

PF01384PHO4120-120 aa

PF01384PHO4159-372 aa

PF20237DUF6594185-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G302030	`PF20237`	DUF6594	34	162	0.042	14.5
TkA05G302030	`PF01384`	PHO4	120	120	1.8e-49	169.4
TkA05G302030	`PF01384`	PHO4	159	372	1.8e-49	169.4
TkA05G302030	`PF20237`	DUF6594	185	233	0.042	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38954`	Arabidopsis thaliana	sp\|Q38954\|PHT21_ARATH Inorganic phosphate transporter 2-1, chloroplastic	71.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card