RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G298180
Reference: TK1151 Chr: Chr05 Coordinates: 73548271-73554326 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4773 bp · TkA05G298180|TK1151|cDNA

CTCGTTCAACGAGCTAACGACGCCGTATTCAACGAGTTCTGACTTAGCGGGTGACTATCGTTTACGCACACTGCAAAACGTTAAAACAAAATTCGACCGTCTTCCACGCCAGATCAACAACGAGAAACCCCCCCAAATTTCCATCCTTTTCGAGATCATATGCTTCAAATCCAATTCAACTACAGTCGCATTCCTTTCTAATTCAAAGAAATGGAAGAGGATAATTATTTGGAGCAGGTGACGGGGAGTCCAACAGCTGG...

CDS

Download CDS FASTA

4368 bp · TkA05G298180|TK1151|CDS

ATGGAAGAGGATAATTATTTGGAGCAGGTGACGGGGAGTCCAACAGCTGGGGAGAATGGATTTGTTCATATTGAGTCAGTTGATTCTGCTCAAATGGAAGGTGGTTCAATTGATCAGGTTGAGCGTCTGGAGCAGGATGATGGGGTAGTGGTAACAGGAGTGGATGCTGTACAGGATGAGCAGCTTTCTGTAAGAACAGCTGATGATGTGGCACCTGATGAGTTTGTAGATTGCCCAGATGACTTGCTTTCTAATGAAGG...

Protein

Download Protein FASTA

1455 aa · TkA05G298180|TK1151|PROTEIN

MEEDNYLEQVTGSPTAGENGFVHIESVDSAQMEGGSIDQVERLEQDDGVVVTGVDAVQDEQLSVRTADDVAPDEFVDCPDDLLSNEGRSPGIPNRPHQLPFGRATEDTQHTEPQIEREILPQEIQEEKGDLIKEVSNLHHLLKSLSKQQTLTDVVDGGEKSLEEMVNECSNFIEISLNEQSHAEATISELNATLHMKDKEIEDLMVRVNVNDQSLSQDIALKSNELASVEAIVDRILYSLTPAFGDSGLSGTSVSEKLSH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G298180
TK1151 IDTkA05G298180
OH-1004 IDLXL04_020715
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)83.500
Protein coverage (%)TK1151 20.412 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G298180
LocationChr05:73548271-73554326 (+)
DescriptionProtein of unknown function
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g24460 Tethering factor involved in vesicle fusion at the trans- Golgi network (TGN) thus being required for efficient protein trafficking to the vacuole.
TNO1 is involved in salt tolerance and vacuolar trafficking in Arabidopsis.2011 · DOI: 10.1104/pp.110.168963
TNO1, a TGN-localized SNARE-interacting protein, modulates root skewing in Arabidopsis thaliana.2017 · DOI: 10.1186/s12870-017-1024-4

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_020715 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006623 protein targeting to vacuole Biological Process
GO:0006886 intracellular protein transport Biological Process
GO:0006906 vesicle fusion Biological Process
GO:0007034 vacuolar transport Biological Process
GO:0009651 response to salt stress Biological Process
GO:0010015 root morphogenesis Biological Process
GO:0010031 circumnutation Biological Process
GO:0010053 root epidermal cell differentiation Biological Process
GO:0010226 response to lithium ion Biological Process
GO:0010555 response to mannitol Biological Process
GO:0022604 regulation of cell morphogenesis Biological Process
GO:0035864 response to potassium ion Biological Process
KEGG gene cross-reference
ath:AT1G24460
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.429
Rank 1 · TkA05G298180 · TK1151
Golgi apparatus0.377
Rank 2 · TkA05G298180 · TK1151
Endoplasmic reticulum0.155
Rank 3 · TkA05G298180 · TK1151
Nucleus0.149
Rank 4 · TkA05G298180 · TK1151
Cell membrane0.076
Rank 5 · TkA05G298180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09787Golgin_A5106-222 aa
PF09787Golgin_A5307-420 aa
PF09787Golgin_A5529-620 aa
PF28882DUF8473554-577 aa
PF09787Golgin_A5638-713 aa
PF09787Golgin_A5677-814 aa
PF10778DehI764-838 aa
PF09787Golgin_A5773-866 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G298180PF09787Golgin_A51062220.0414.2
TkA05G298180PF09787Golgin_A53074200.0414.2
TkA05G298180PF09787Golgin_A55296200.0414.2
TkA05G298180PF28882DUF84735545770.02515.0
TkA05G298180PF09787Golgin_A56387130.0414.2
TkA05G298180PF09787Golgin_A56778140.0414.2
TkA05G298180PF10778DehI7648380.0215.6
TkA05G298180PF09787Golgin_A57738660.0414.2
TkA05G298180PF09787Golgin_A589010310.0414.2
TkA05G298180PF28882DUF847396210160.02515.0
TkA05G298180PF09787Golgin_A5110812090.0414.2
TkA05G298180PF09787Golgin_A5125813330.0414.2
TkA05G298180PF09787Golgin_A5141214510.0414.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4I9A2Arabidopsis thalianasp|F4I9A2|TNO1_ARATH Trans-Golgi network-localized SYP41-interacting protein 132.500%Swiss-ProtMedium

JBrowse

View in Genome Browser