TkA05G284770 | RubberDandelionOmics

Gene overview

TkA05G284770

Reference: TK1151 Chr: Chr05 Coordinates: 70307992-70309689 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

630 bp · TkA05G284770|TK1151|cDNA

ATGGTAATCTTTATGTTTTGTGTCTCTGCTTCATCTAAACTTTTGAGGATTTCGGATCTATCCCCCGGCGACGACACCAGGAAAGATTCCTTACCCAGATTGAACGGCGTTTCTCAAGACGGACTATCTTTGCTGGTTACGGCACAATTCAATCTCGATCTTTTGGCCACTCAGCTTCCCACAGATGATCATATTCAAAATGCCCGAACGCTGCTTCAATCATGGAGCAAAGAAATTCAAAGCCTGCGGTCAAGTTTAAG...

CDS

Download CDS FASTA

630 bp · TkA05G284770|TK1151|CDS

ATGGTAATCTTTATGTTTTGTGTCTCTGCTTCATCTAAACTTTTGAGGATTTCGGATCTATCCCCCGGCGACGACACCAGGAAAGATTCCTTACCCAGATTGAACGGCGTTTCTCAAGACGGACTATCTTTGCTGGTTACGGCACAATTCAATCTCGATCTTTTGGCCACTCAGCTTCCCACAGATGATCATATTCAAAATGCCCGAACGCTGCTTCAATCATGGAGCAAAGAAATTCAAAGCCTGCGGTCAAGTTTAAG...

Protein

Download Protein FASTA

209 aa · TkA05G284770|TK1151|PROTEIN

MVIFMFCVSASSKLLRISDLSPGDDTRKDSLPRLNGVSQDGLSLLVTAQFNLDLLATQLPTDDHIQNARTLLQSWSKEIQSLRSSLRHANLQAKANMRKAAKEERELLLGGGEETTARRRNLQRLKEVETHSWLLTTEESTGVLKKKPKVNTKKVVSVQIEKHPTLIVVLNKGYFGQLRMQQNFYNCRGFYRVEGQNWKFQFRCRRMGV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G284770`
TK1151 ID	TkA05G284770
OH-1004 ID	LXL04_033338
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	65.100
Protein coverage (%)	TK1151 60.287 / OH-1004 49.175 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G284770`
Location	Chr05:70307992-70309689 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033338` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006886 intracellular protein transport Biological Process GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process GO:0007029 endoplasmic reticulum organization Biological Process GO:0014823 response to activity Biological Process GO:0015031 protein transport Biological Process GO:0016320 endoplasmic reticulum membrane fusion Biological Process GO:0042594 response to starvation Biological Process GO:0090649 response to oxygen-glucose deprivation Biological Process GO:0005635 nuclear envelope Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component
KEGG gene cross-reference	hsa:662 mmu:224630 rno:140932 spo:2541996 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.554

Rank 1 · TkA05G284770 · TK1151

Cytoplasm0.368

Rank 2 · TkA05G284770 · TK1151

Mitochondrion0.097

Rank 3 · TkA05G284770 · TK1151

Cell membrane0.056

Rank 4 · TkA05G284770 · TK1151

Endoplasmic reticulum0.044

Rank 5 · TkA05G284770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27021BOS1_GOSR2_MEM11-like_N31-110 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G284770	`PF27021`	BOS1_GOSR2_MEM11-like_N	31	110	0.0037	18.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card