TkA05G159580 | RubberDandelionOmics

Gene overview

TkA05G159580

Reference: TK1151 Chr: Chr05 Coordinates: 41174241-41177533 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1732 bp · TkA05G159580|TK1151|cDNA

AACACCCTCACATCTCCCTCTTGGCAGTACACGGATCGCTGACTCCTCAAATGTACACACATGCTTGAGTTCCTTGCGCCATCCCTTCGCTCGATCAACAACAATTCACCATACCTCCAACATCAGACACTCCCCATCACATCATTCGCTCTCTTACACACTGATCTCACTCTCTCAAAACATTACGAAGCAAAAAAAAGGTAGTGGATGACCATAGATGCTGCCATACTTCATCTGCTACAAATCAGCGCACAATTTCG...

CDS

Download CDS FASTA

870 bp · TkA05G159580|TK1151|CDS

ATGCTGGTTATGGAGGGATTGGGGAAATCGGTAGAGCCCTGTTTGTGTGTTTGTGTCTTTGCAAGCAGTATTTCGTTTGCCGAGTTTAGAACTTTATTTAGCAGCAATATAAGTGATGCACGTGTATTTATCCTTGAGATGATCACATCCATTCCATGGAAAGAAAATGAGCTAAACATGGTTGATACACCTGGACACGCAGATTTTGGTGGTGAGGTGGAGCGGGTTGTTGGGATGGTTGAAGGAGCAATTTTAGTGGT...

Protein

Download Protein FASTA

289 aa · TkA05G159580|TK1151|PROTEIN

MLVMEGLGKSVEPCLCVCVFASSISFAEFRTLFSSNISDARVFILEMITSIPWKENELNMVDTPGHADFGGEVERVVGMVEGAILVVDAGEGPLAQTKFVLAKALRYGLRPILLLNKVDRPFVSEERCDEVESLVFDLIANLGASEEQLDFPVLYASAKEGWASLTYTKNPPDDAKNMSQLLDAIVKYVPPTTASLDEPFQMLVSMMEKDDYVGRILTGRITSGVVRINDRVHGLRHSDSGSSKLKMEKGELQLGILPEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G159580`
TK1151 ID	TkA05G159580
OH-1004 ID	LXL04_022873
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.700
Protein coverage (%)	TK1151 100.000 / OH-1004 77.686 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G159580`
Location	Chr05:41174241-41177533 (-)
Description	Similar to bipA: 50S ribosomal subunit assembly factor BipA (Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022873` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000027 ribosomal large subunit assembly Biological Process GO:0006412 translation Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0010467 gene expression Biological Process GO:0005829 cytosol Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0000049 tRNA binding Molecular Function GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function GO:0019843 rRNA binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	ecj:JW5571 eco:b3871 ecoc:C3026_20930 hin:HI_0864 sfl:SF3941 sfx:S3805 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.402

Rank 1 · TkA05G159580 · TK1151

Nucleus0.206

Rank 2 · TkA05G159580 · TK1151

Mitochondrion0.184

Rank 3 · TkA05G159580 · TK1151

Endoplasmic reticulum0.120

Rank 4 · TkA05G159580 · TK1151

Peroxisome0.107

Rank 5 · TkA05G159580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04548AIG131-74 aa

PF00009GTP_EFTU49-191 aa

PF01926MMR_HSR151-117 aa

PF03144GTP_EFTU_D2214-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G159580	`PF04548`	AIG1	31	74	0.33	11.0
TkA05G159580	`PF00009`	GTP_EFTU	49	191	1.5e-30	106.9
TkA05G159580	`PF01926`	MMR_HSR1	51	117	0.23	12.3
TkA05G159580	`PF03144`	GTP_EFTU_D2	214	244	0.006	17.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card