TkA05G072180 | RubberDandelionOmics

Gene overview

TkA05G072180

Reference: TK1151 Chr: Chr05 Coordinates: 19260156-19263355 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1412 bp · TkA05G072180|TK1151|cDNA

CCCTACCTTTTAGTTCTCAACAAAAACCTAACTTTGTGATTCCGTATCCGGTTCAGTGACAATTAGTCAAACACCTCGTTGTGTGTGAGCAAATCCCAGTGTATTCCATCAAGAACACGAATTAATACACCAAACGACAAATAAATTATTCATTTTTGCGTAGTCTGATAAGTTCTGCTCCAAAAACGGAGGATTAAGAAGCAAATAAACGTTAAATCAATTCACAGACTGACATGCCATGTTAAAAAAAGGGGGAAAAA...

CDS

Download CDS FASTA

738 bp · TkA05G072180|TK1151|CDS

ATGTATGAGAAGGAAGAAGAATCTGAATCTGAATCAGAAATGGGTCGAGAGATTTCGAATCTTCTACGGCCGCGATTCCTCGTTATCTTCTTGATCGGTTCAGTTCTTGTCTTCCTCGCCTTCTCGTCGTTCTCTGAACAGGAGGAAGAGACAGTGGAGGAGGTGCATGAAATTACTCACAGAGTTTTCCTGGATGTTGATATTGACAAACAACGGTTAGGAAGAATTGTTATTGGATTGTATGGAGAAGTTGTGCCAAA...

Protein

Download Protein FASTA

245 aa · TkA05G072180|TK1151|PROTEIN

MYEKEEESESESEMGREISNLLRPRFLVIFLIGSVLVFLAFSSFSEQEEETVEEVHEITHRVFLDVDIDKQRLGRIVIGLYGEVVPKTVENFRALCTGELGKGNKGKILLHYKGTPFHRIIPGFMIQGGDIVFRDGRGNESIYGGTFRDENFKIKHSHPGMVAMVNSGPDSNGSQFFITTVKAYWLDGEHVVFGKVMEGMDNVYAIEGGAGTYSGKPRKKVVISDSGEIPKSEWNREAGITTTES

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G072180`
TK1151 ID	TkA05G072180
OH-1004 ID	LXL04_019660
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G072180

Location Chr05:19260156-19263355 (-)

Description Similar to CYP21-1: Peptidyl-prolyl cis-trans isomerase CYP21-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34960`	PPIases accelerate the folding of proteins.	No verified direct reference in this release
`At2g29960`	PPIases accelerate the folding of proteins.	A conserved domain of the arabidopsis GNOM protein mediates subunit interaction and cyclophilin 5 binding.2000 · DOI: 10.1105/tpc.12.3.343
`At5g58710`	PPIases accelerate the folding of proteins.	Mutations in a new Arabidopsis cyclophilin disrupt its interaction with protein phosphatase 2A.1999 · DOI: 10.1007/s004380051147
`At3g55920`	PPIases accelerate the folding of proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019660 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0048364 root development Biological Process

GO:0061083 regulation of protein refolding Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005771 multivesicular body Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005795 Golgi stack Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

KEGG gene cross-reference

ath:AT2G29960

ath:AT3G55920

ath:AT4G34960

ath:AT5G58710

ddi:DDB_G0269120

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.464

Rank 1 · TkA05G072180 · TK1151

Endoplasmic reticulum0.283

Rank 2 · TkA05G072180 · TK1151

Lysosome / Vacuole0.086

Rank 3 · TkA05G072180 · TK1151

Cytoplasm0.081

Rank 4 · TkA05G072180 · TK1151

Cell membrane0.059

Rank 5 · TkA05G072180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00160Pro_isomerase66-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G072180	`PF00160`	Pro_isomerase	66	225	1.2e-47	162.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49605`	Arabidopsis thaliana	sp\|O49605\|CP21A_ARATH Peptidyl-prolyl cis-trans isomerase CYP21-1	73.500%	Swiss-Prot	High
`Q8LDP4`	Arabidopsis thaliana	sp\|Q8LDP4\|CP19D_ARATH Peptidyl-prolyl cis-trans isomerase CYP19-4	60.000%	Swiss-Prot	High
`Q9SP02`	Arabidopsis thaliana	sp\|Q9SP02\|CP20A_ARATH Peptidyl-prolyl cis-trans isomerase CYP20-1	64.900%	Swiss-Prot	High
`Q8L8W5`	Arabidopsis thaliana	sp\|Q8L8W5\|CP21B_ARATH Peptidyl-prolyl cis-trans isomerase CYP21-2	61.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card