TkA05G071490 | RubberDandelionOmics

Gene overview

TkA05G071490

Reference: TK1151 Chr: Chr05 Coordinates: 19079865-19080475 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

506 bp · TkA05G071490|TK1151|cDNA

TTCTTCACGCAATCTTCTTTTTTTTCAACAAAACCCCAATTTACGGAGAGTTGTTCGTATACATGTAAATGGCGAAAAGCGGGGTGTTTGAAAGGGATCCCACCGCCGCAACGAAGGTGGCCACCGACAACTTGAAGAAGGAATTACAGCGACTTGTTAATTCGATTGTGGAGGAATCTTCACCAGATGAAGAAAACGGATTTGGATTTACGGATTGTATTGATAGAGCTACTCAAACTTTACAGAGTTTGAAGGATTTG...

CDS

Download CDS FASTA

324 bp · TkA05G071490|TK1151|CDS

ATGGCGAAAAGCGGGGTGTTTGAAAGGGATCCCACCGCCGCAACGAAGGTGGCCACCGACAACTTGAAGAAGGAATTACAGCGACTTGTTAATTCGATTGTGGAGGAATCTTCACCAGATGAAGAAAACGGATTTGGATTTACGGATTGTATTGATAGAGCTACTCAAACTTTACAGAGTTTGAAGGATTTGAAACATCGATCATTAGATAATACGAGTTTTGATTCGTGCCCTAAAGAATTCAACTGCCCCCTTTCGAA...

Protein

Download Protein FASTA

107 aa · TkA05G071490|TK1151|PROTEIN

MAKSGVFERDPTAATKVATDNLKKELQRLVNSIVEESSPDEENGFGFTDCIDRATQTLQSLKDLKHRSLDNTSFDSCPKEFNCPLSKEIMRDPVIISSGETYDRASI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G071490`
TK1151 ID	TkA05G071490
OH-1004 ID	LXL04_000789
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.000
Protein coverage (%)	TK1151 93.458 / OH-1004 20.161 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G071490

Location Chr05:19079865-19080475 (+)

Description Similar to PUB9: U-box domain-containing protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07360`	Functions as an E3 ubiquitin ligase (By similarity).	Interactions between the S-domain receptor kinases and AtPUB-ARM E3 ubiquitin ligases suggest a conserved signaling pathway in Arabidopsis.2008 · DOI: 10.1104/pp.108.123380
`At5g18320`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At3g54850`	Functions as an E3 ubiquitin ligase with specific E2 ubiquitin-conjugating enzymes.	Structure and biochemical function of a prototypical Arabidopsis U-box domain.2004 · DOI: 10.1074/jbc.m405057200

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0234300`	Possesses E3 ubiquitin-protein ligase in vitro.	No verified direct reference in this release
`Os06g0102700`	Possesses E3 ubiquitin-protein ligase in vitro.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000789 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048527 lateral root development Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G28830

ath:AT3G07360

ath:AT3G46510

ath:AT5G18320

dosa:Os06g0102700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.661

Rank 1 · TkA05G071490 · TK1151

Cytoplasm0.452

Rank 2 · TkA05G071490 · TK1151

Cell membrane0.044

Rank 3 · TkA05G071490 · TK1151

Mitochondrion0.041

Rank 4 · TkA05G071490 · TK1151

Endoplasmic reticulum0.030

Rank 5 · TkA05G071490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04564U-box11-24 aa

PF20669Exo70_N16-31 aa

PF20669Exo70_N36-71 aa

PF04564U-box78-107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G071490	`PF04564`	U-box	11	24	6.5e-10	39.8
TkA05G071490	`PF20669`	Exo70_N	16	31	0.032	15.2
TkA05G071490	`PF20669`	Exo70_N	36	71	0.032	15.2
TkA05G071490	`PF04564`	U-box	78	107	6.5e-10	39.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRT0`	Arabidopsis thaliana	sp\|Q9SRT0\|PUB9_ARATH U-box domain-containing protein 9	41.600%	Swiss-Prot	Medium
`Q3E9F7`	Arabidopsis thaliana	sp\|Q3E9F7\|PUB46_ARATH Putative U-box domain-containing protein 46	35.400%	Swiss-Prot	Medium
`Q8VZ40`	Arabidopsis thaliana	sp\|Q8VZ40\|PUB14_ARATH U-box domain-containing protein 14	31.700%	Swiss-Prot	Medium
`Q6EUK7`	Oryza sativa subsp. japonica	sp\|Q6EUK7\|PUB04_ORYSJ U-box domain-containing protein 4	65.800%	Swiss-Prot	Low
`Q5VRH9`	Oryza sativa subsp. japonica	sp\|Q5VRH9\|PUB12_ORYSJ U-box domain-containing protein 12	34.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card