TkA05G070280 | RubberDandelionOmics

Gene overview

TkA05G070280

Reference: TK1151 Chr: Chr05 Coordinates: 18833711-18835858 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1602 bp · TkA05G070280|TK1151|cDNA

TAAAAAGTCTCCCTCGCTCTTTGTACTTCCTGTTCTGCAGATTCCTTAAACGAATGGTCCTCCTTCAATAATTTTCCTCTCGCCATTGATATCAATCCCTTTTCTAGAGCTTTTTCCCCTTCCCCACTTACCATCTCTGCTTTCAGGTTTCACAGGTCGGTCGAGCGATTCTGTTAATTTTAGGGTTTCTTAAAGAAATCGACAACATATGGTCAGTCGAACAATTCTCCAGATTCTAGGGTTTCTTTACAGCTCCGTTG...

CDS

Download CDS FASTA

828 bp · TkA05G070280|TK1151|CDS

ATGGAGGACGGAGAACTCGAATTCTCAACCAACGAAATGTTCCCAGGTCCAACAATCGGAGACATCCCAAGCAACGATTCAATGGACAGTTTCTTCAACGACATTTTCAAAGACACCCACGCATGCACCCACACCCACACCTGCAACCCACCAGGCCCCGATTCCTCCCACACCCACACCTGCTACCATGTCCACACCAAAATTGTCCCCGCCATGAGTGGTGATGATGACAAGACCCCGACAGATGACACAGCTGAGTC...

Protein

Download Protein FASTA

275 aa · TkA05G070280|TK1151|PROTEIN

MEDGELEFSTNEMFPGPTIGDIPSNDSMDSFFNDIFKDTHACTHTHTCNPPGPDSSHTHTCYHVHTKIVPAMSGDDDKTPTDDTAESTEKKVNNKKRPVGNREAVRKYREKKKARAASLEDEVVRLRAMNQQLMKRIQSQAGLEGEVARLKCLLVDIRGRIEGEIGYFPYQKNNPVVNSVNLNSVNLGGGYVMNPCNMQCGDQVYCLHPDGKTGGNASIHDPVLNGCEFENLQCLGNQNSVIDGLQGCENEDGFVATNQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G070280`
TK1151 ID	TkA05G070280
OH-1004 ID	LXL04_019636
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G070280

Location Chr05:18833711-18835858 (-)

Description Similar to BZIP23: Basic leucine zipper 23

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g16770`	Transcription factor involved in the response to zinc ion deficiency.	Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency.2010 · DOI: 10.1073/pnas.1004788107 Identification of putative target genes of bZIP19, a transcription factor essential for Arabidopsis adaptation to Zn deficiency in roots.2015 · DOI: 10.1111/tpj.12996
`At4g35040`	Transcription factor involved in the response to zinc ion deficiency.	Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency.2010 · DOI: 10.1073/pnas.1004788107 Identification of putative target genes of bZIP19, a transcription factor essential for Arabidopsis adaptation to Zn deficiency in roots.2015 · DOI: 10.1111/tpj.12996
`At3g51960`	Transcription factor involved in the regulation of salt stress response.	Differential transcript regulation in Arabidopsis thaliana and the halotolerant Lobularia maritima indicates genes with potential function in plant salt adaptation.2008 · DOI: 10.1016/j.gene.2008.07.017 The Arabidopsis basic leucine zipper transcription factor AtbZIP24 regulates complex transcriptional networks involved in abiotic stress resistance.2009 · DOI: 10.1016/j.gene.2009.02.010

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019636 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:1901001 negative regulation of response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific Molecular Function

KEGG gene cross-reference

ath:AT2G16770

ath:AT3G51960

ath:AT4G35040

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.983

Rank 1 · TkA05G070280 · TK1151

Cytoplasm0.077

Rank 2 · TkA05G070280 · TK1151

Cell membrane0.021

Rank 3 · TkA05G070280 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA05G070280 · TK1151

Plastid0.007

Rank 5 · TkA05G070280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30360Shootin64-154 aa

PF00170bZIP_189-139 aa

PF25764KIF21A_4th89-141 aa

PF28121VPA126789-139 aa

PF27978ZNF318_helical92-141 aa

PF07716bZIP_294-138 aa

PF14077WDR18_C110-133 aa

PF14077WDR18_C143-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G070280	`PF30360`	Shootin	64	154	0.051	13.8
TkA05G070280	`PF00170`	bZIP_1	89	139	7.6e-08	33.1
TkA05G070280	`PF25764`	KIF21A_4th	89	141	0.044	14.2
TkA05G070280	`PF28121`	VPA1267	89	139	0.22	12.4
TkA05G070280	`PF27978`	ZNF318_helical	92	141	0.01	17.0
TkA05G070280	`PF07716`	bZIP_2	94	138	3.1e-11	43.8
TkA05G070280	`PF14077`	WDR18_C	110	133	0.16	12.5
TkA05G070280	`PF14077`	WDR18_C	143	151	0.16	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GTS2`	Arabidopsis thaliana	sp\|Q8GTS2\|BZP23_ARATH Basic leucine zipper 23	56.500%	Swiss-Prot	High
`Q8VY76`	Arabidopsis thaliana	sp\|Q8VY76\|BZP19_ARATH Basic leucine zipper 19	59.200%	Swiss-Prot	High
`Q8GTS1`	Arabidopsis thaliana	sp\|Q8GTS1\|BZP24_ARATH Basic leucine zipper 24	42.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card