TkA05G063920 | RubberDandelionOmics

Gene overview

TkA05G063920

Reference: TK1151 Chr: Chr05 Coordinates: 17049130-17053027 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3046 bp · TkA05G063920|TK1151|cDNA

GCAAAATGCTGTCTGTCAGTTAAGTGACTAAGTCACTGAAAAGTTTCATAAAAATCCCTCAACATATAACTAACGACCCAATTTAGTCCCTGAACTCATCAACTAGTTTACCGATGGAGACCTTTTTCAACATGAAGTAGACAAGTCTTAGACTCTCACCCAAACAACGGTATCTTCTCTCCTTCTCTCTCTGTCTCTCTCTCTACCACTCTCGCAGTTTTTATTTTTACGCAGATACATTCAAATGAAGCAAGTATTTG...

CDS

Download CDS FASTA

2244 bp · TkA05G063920|TK1151|CDS

ATGAGCGGAGCTGTGCTAGTGGCCGTTGCCGCCGCCGTTGGTAACTTGCTTCAGGGATGGGATAACGCCACTATTGCCGGCGCTGTATTATACATAAAGAAAGAGTTCAACTTGGAAAGCGAACCAACCATCGAAGGTCTAATCGTGGCCATGTCCTTAATCGGCGCGACCGTGGTGACAACTTTCTCCGGCGGAATAGCAGATTCATACGGCCGACGTCCGATGCTCATCATCTCTTCTGTCCTATACTTCATTAGCGG...

Protein

Download Protein FASTA

747 aa · TkA05G063920|TK1151|PROTEIN

MSGAVLVAVAAAVGNLLQGWDNATIAGAVLYIKKEFNLESEPTIEGLIVAMSLIGATVVTTFSGGIADSYGRRPMLIISSVLYFISGLVMLWSPNVYILLLARLLDGLGIGLAVTLVPVYISETAPPEIRGSLNTLPQFTGSGGMFLSYCMVFGMSLMESPNWRLMLGVLSIPSLVYFVLTVFFLPESPRWLVSKGRMQEAKQVLQRLRGKEDVSGEMALLVEGLGVGGETSIEEYIIGPANDIEEDQDEAAKIKLYGHD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G063920`
TK1151 ID	TkA05G063920
OH-1004 ID	LXL04_019565
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 97.775 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G063920

Location Chr05:17049130-17053027 (+)

Description Similar to MSSP2: Monosaccharide-sensing protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35300`	Sugar proton-coupled antiporter which contributes to vacuolar sugar import (e.g. monosaccharides including glucose, sucrose and fructose), particularly during stress responses (e.g. in response to cold).	Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport.2006 · DOI: 10.1105/tpc.106.047290 Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2.2011 · DOI: 10.1111/j.1365-313x.2011.04672.x
`At3g51490`	Sugar proton-coupled antiporter which contributes to vacuolar sugar import (e.g. monosaccharides including glucose,sucrose and fructose), particularly during stress responses (e.g. in response to cold).	Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport.2006 · DOI: 10.1105/tpc.106.047290
`At1g20840`	Sugar proton-coupled antiporter which contributes to vacuolar sugar import (e.g. monosaccharides including glucose, sucrose and fructose), particularly during stress responses (e.g. in response to cold).	Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport.2006 · DOI: 10.1105/tpc.106.047290 Increased activity of the vacuolar monosaccharide transporter TMT1 alters cellular sugar partitioning, sugar signaling, and seed yield in Arabidopsis.2010 · DOI: 10.1104/pp.110.162040 Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2.2011 · DOI: 10.1111/j.1365-313x.2011.04672.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019565 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009624 response to nematode Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009749 response to glucose Biological Process

GO:0009750 response to fructose Biological Process

GO:0015798 myo-inositol transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:1902074 response to salt Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G20840

ath:AT2G35740

ath:AT3G51490

ath:AT4G35300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.396

Rank 1 · TkA05G063920 · TK1151

Cytoplasm0.236

Rank 2 · TkA05G063920 · TK1151

Cell membrane0.233

Rank 3 · TkA05G063920 · TK1151

Golgi apparatus0.174

Rank 4 · TkA05G063920 · TK1151

Endoplasmic reticulum0.110

Rank 5 · TkA05G063920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083Sugar_tr7-224 aa

PF07690MFS_112-201 aa

PF06609TRI1246-196 aa

PF21659Flavi_E_stem261-284 aa

PF00083Sugar_tr506-734 aa

PF21659Flavi_E_stem525-579 aa

PF07690MFS_1559-723 aa

PF06609TRI12560-626 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G063920	`PF00083`	Sugar_tr	7	224	1.2e-95	321.8
TkA05G063920	`PF07690`	MFS_1	12	201	2.3e-32	113.0
TkA05G063920	`PF06609`	TRI12	46	196	0.28	10.3
TkA05G063920	`PF21659`	Flavi_E_stem	261	284	0.0045	18.1
TkA05G063920	`PF00083`	Sugar_tr	506	734	1.2e-95	321.8
TkA05G063920	`PF21659`	Flavi_E_stem	525	579	0.0045	18.1
TkA05G063920	`PF07690`	MFS_1	559	723	2.3e-32	113.0
TkA05G063920	`PF06609`	TRI12	560	626	0.28	10.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPQ8`	Arabidopsis thaliana	sp\|Q8LPQ8\|MSSP2_ARATH Monosaccharide-sensing protein 2	70.900%	Swiss-Prot	High
`Q9SD00`	Arabidopsis thaliana	sp\|Q9SD00\|MSSP3_ARATH Monosaccharide-sensing protein 3	60.100%	Swiss-Prot	High
`Q96290`	Arabidopsis thaliana	sp\|Q96290\|MSSP1_ARATH Monosaccharide-sensing protein 1	60.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card