Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1587 bp · TkA05G062120|TK1151|cDNA
TTAGATCCGATTATCATCATCCAAAGCAATCTCATCAAAATTCACATCTAAATATTAAAATACACCTTTGCTCCAGATGTTAAACATCTCGTGTTGATTCACAAGATAGCACTTTTACTAAGATACTACCACCAGTAGAGATCACTCCGTCTACCGTCCACCGTCCACCGTCCACCGTTGTTGTTCGTTTCCGCCATCTACTTCATTAGTTGCTCATACACTCCTCCAACCGACATCTTTCTGGATTCAGTTTCCACAAC...
1038 bp · TkA05G062120|TK1151|CDS
ATGGAGTACCGAAGAATCAAAGATCAGGATAAGGATGTGGATCCGGTTAATGAAGATCTCGAGAGCTTACGCGGCAAAGCTCTTTTAGATGTTCCTCCACCTTATGATAAAACAAAATGGAAGATGAAGTCGGTGGTGACACTAGCATTAACATTTCTAACAAGCTCCCAAGCCATCCTTATCGTCTGGTCCAAAAGAGCTGGAAGATACGAGTACAGTGTCACAACAGCAAACTTTTTGGTTGAGACTTTGAAATGTGC...
Protein
Download Protein FASTA345 aa · TkA05G062120|TK1151|PROTEIN
MEYRRIKDQDKDVDPVNEDLESLRGKALLDVPPPYDKTKWKMKSVVTLALTFLTSSQAILIVWSKRAGRYEYSVTTANFLVETLKCALSLAALARTWRTEGVTEDNRLSTTVDEVSVYPIPAALYLVKNLLQYYIFAYVDAPGYQILKNLNIISTGVLYRIILKKKLSEIQWAAFILLCAGCTTAQLNPSSDHVLQTPFLGWMMAIVMALLSGFAGVYTEAIIKKRPSRNINVQNFWLYVFGMAFNVVAIIVQDFDAVVN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G062120 |
|---|---|
| TK1151 ID | TkA05G062120 |
| OH-1004 ID | LXL04_019557 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G062120 | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr05:16535691-16539058 (-) | |||||||||||||||||||||
| Description | Similar to CSTLP2: CMP-sialic acid transporter 2 | |||||||||||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| |||||||||||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||||||||||||||
| GO annotations (OH1004 source) | GO:0015739 sialic acid transport Biological Process GO:0055085 transmembrane transport Biological Process GO:0000139 Golgi membrane Cellular Component GO:0005768 endosome Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005802 trans-Golgi network Cellular Component GO:0005886 plasma membrane Cellular Component GO:0015136 sialic acid transmembrane transporter activity Molecular Function GO:0015165 pyrimidine nucleotide-sugar transmembrane transporter activity Molecular Function GO:0022857 transmembrane transporter activity Molecular Function | |||||||||||||||||||||
| KEGG gene cross-reference | dosa:Os06g0523400 dosa:Os07g0573700 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04142Nuc_sug_transp40-338 aaPF00892EamA56-182 aaPF08449UAA99-339 aaPF00892EamA201-337 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA05G062120 | PF04142 | Nuc_sug_transp | 40 | 338 | 1.2e-57 | 196.1 |
| TkA05G062120 | PF00892 | EamA | 56 | 182 | 6.3e-06 | 27.2 |
| TkA05G062120 | PF08449 | UAA | 99 | 339 | 1.4e-10 | 41.6 |
| TkA05G062120 | PF00892 | EamA | 201 | 337 | 6.3e-06 | 27.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
F4JN00 | Arabidopsis thaliana | sp|F4JN00|CSTR4_ARATH CMP-sialic acid transporter 4 | 80.800% | Swiss-Prot | High |
Q8LGE9 | Arabidopsis thaliana | sp|Q8LGE9|CSTR1_ARATH CMP-sialic acid transporter 1 | 42.400% | Swiss-Prot | Medium |
Q6ZL17 | Oryza sativa subsp. japonica | sp|Q6ZL17|CSTR2_ORYSJ CMP-sialic acid transporter 2 | 81.600% | Swiss-Prot | High |
B8B7Q4 | Oryza sativa subsp. indica | sp|B8B7Q4|CSTR2_ORYSI CMP-sialic acid transporter 2 | 81.300% | Swiss-Prot | High |
Q654D9 | Oryza sativa subsp. japonica | sp|Q654D9|CSTR1_ORYSJ CMP-sialic acid transporter 1 | 40.600% | Swiss-Prot | Medium |