RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G056870
Reference: TK1151 Chr: Chr05 Coordinates: 15138547-15150732 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1518 bp · TkA05G056870|TK1151|cDNA

TTTCCAGCACTGCCAATTTCGTCTCTGTTTCCATTTCTTTATTTCATGATAAAGGATTTTAATATTGCGGAAAAAGAGGAGGACATTAGTTATTATGCAGGGTTTGTGGGATCTGCGTATATGATTGGACGGGCATTGACATCTGTGTTTTGGGGAGTAGTGGCTGATAAATATGGTCGCAAACCAGTTATTCTTTTGGGCACTTCAACAGTGGTTATTTTCAATACACTTTTTGGGTTTAGTGTAAATTATTGGATGGC...

CDS

Download CDS FASTA

1428 bp · TkA05G056870|TK1151|CDS

ATGACGAACAAAGATGAGCTAGAAAAGGAGCTTTTGGAGCAAGTATACCACGAAAACTGTCCCGGTTGTAAAGTGGATCGTCAAAAACGGATGCACACGGGGTTACCCGTTAAGGAGCTTATTTTTATCTGGATAGTCGTCTTATGTGTTGCACTGCCAATTTCGTCTCTGTTTCCATTTCTTTATTTCATGATAAAGGATTTTAATATTGCGGAAAAAGAGGAGGACATTAGTTATTATGCAGGGTTTGTGGGATCTGC...

Protein

Download Protein FASTA

475 aa · TkA05G056870|TK1151|PROTEIN

MTNKDELEKELLEQVYHENCPGCKVDRQKRMHTGLPVKELIFIWIVVLCVALPISSLFPFLYFMIKDFNIAEKEEDISYYAGFVGSAYMIGRALTSVFWGVVADKYGRKPVILLGTSTVVIFNTLFGFSVNYWMAIATRFLLGFLNGLLGPIKAYACELFPEEHQALGLSAISTSWGIGLIIGPALGGYLAQPAEKFPSLVSPDSLFGRFPYLLPCLCISIFAFFVTIAAFWLPETLHFHKKDELESASYDTEEKSNKEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G056870
TK1151 IDTkA05G056870
OH-1004 IDLXL04_019501
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)97.900
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G056870
LocationChr05:15138547-15150732 (-)
DescriptionSimilar to ZIFL1: Protein ZINC INDUCED FACILITATOR-LIKE 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g13750 May participate in solute transport and auxin-related responses.
Heterologous expression of a Tpo1 homolog from Arabidopsis thaliana confers resistance to the herbicide 2,4-D and other chemical stresses in yeast.2009 · DOI: 10.1007/s00253-009-2025-5
A major facilitator superfamily transporter plays a dual role in polar auxin transport and drought stress tolerance in Arabidopsis.2013 · DOI: 10.1105/tpc.113.110353
At5g13740 Major facilitator superfamily (MFS) transporter involved in zinc tolerance by participating in vacuolar sequestration of zinc.
A novel major facilitator superfamily protein at the tonoplast influences zinc tolerance and accumulation in Arabidopsis.2007 · DOI: 10.1104/pp.106.092015
At3g43790 Probable peptide/nitrate transporter At3g43790. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019501 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006882 intracellular zinc ion homeostasis Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009624 response to nematode Biological Process
GO:0009630 gravitropism Biological Process
GO:0010043 response to zinc ion Biological Process
GO:0010540 basipetal auxin transport Biological Process
GO:0048364 root development Biological Process
GO:0090333 regulation of stomatal closure Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009705 plant-type vacuole membrane Cellular Component
KEGG gene cross-reference
afm:AFUA_1G15490
ath:AT3G43790
ath:AT5G13740
ath:AT5G13750
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.324
Rank 1 · TkA05G056870 · TK1151
Lysosome / Vacuole0.220
Rank 2 · TkA05G056870 · TK1151
Endoplasmic reticulum0.184
Rank 3 · TkA05G056870 · TK1151
Cytoplasm0.177
Rank 4 · TkA05G056870 · TK1151
Golgi apparatus0.117
Rank 5 · TkA05G056870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17915zf_Rg13-38 aa
PF07690MFS_143-425 aa
PF00083Sugar_tr72-257 aa
PF06609TRI1282-190 aa
PF00137ATP-synt_C83-103 aa
PF12713DUF380691-122 aa
PF10746Phage_holin_2_2111-138 aa
PF15108TMEM37122-150 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G056870PF17915zf_Rg13380.112.8
TkA05G056870PF07690MFS_1434252.8e-42145.6
TkA05G056870PF00083Sugar_tr722579.5e-1658.4
TkA05G056870PF06609TRI12821900.004216.3
TkA05G056870PF00137ATP-synt_C831030.01716.1
TkA05G056870PF12713DUF3806911220.3211.4
TkA05G056870PF10746Phage_holin_2_21111380.1112.9
TkA05G056870PF15108TMEM371221500.1412.8
TkA05G056870PF00137ATP-synt_C1662330.01716.1
TkA05G056870PF10746Phage_holin_2_22672970.1112.9
TkA05G056870PF15108TMEM373613990.1412.8
TkA05G056870PF00083Sugar_tr3964669.5e-1658.4
TkA05G056870PF07690MFS_13994632.8e-42145.6
TkA05G056870PF17915zf_Rg4174320.112.8
TkA05G056870PF00137ATP-synt_C4204450.01716.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q94BZ1Arabidopsis thalianasp|Q94BZ1|ZIFL1_ARATH Protein ZINC INDUCED FACILITATOR-LIKE 165.100%Swiss-ProtHigh
Q8RWN2Arabidopsis thalianasp|Q8RWN2|ZIF1_ARATH Protein ZINC INDUCED FACILITATOR 160.700%Swiss-ProtHigh
Q3EAQ5Arabidopsis thalianasp|Q3EAQ5|PTR36_ARATH Probable peptide/nitrate transporter At3g4379056.900%Swiss-ProtHigh

JBrowse

View in Genome Browser