TkA05G056260 | RubberDandelionOmics

Gene overview

TkA05G056260

Reference: TK1151 Chr: Chr05 Coordinates: 14960106-14976834 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6222 bp · TkA05G056260|TK1151|cDNA

TCTCAACCTCTTACGAGACGTCACGTGTCCCCTTGCAAACAGATTTTGCATCCTCCTCTTCCCGCCCGGAAATCACGAGGAAGTTTATGAGAAATTTCATTTACCACCAAATCTAACGTCCGTTTCTCTCTCTGTAATCTCGTGTTTATCGTTGCAAAAGATCGTCGCCGAAGAAGATCATCATCAAAAAGATCTACATATTCAGGGGGAGAGAATGAAGAGGTGAATATCTAAGAGATAAGGAGAAAGATGGAAGAAGG...

CDS

Download CDS FASTA

3477 bp · TkA05G056260|TK1151|CDS

ATGTTGAGGTCACGCTTCCAGTCTATACCCGGTGCATTCAATGCGTATTTGTTGCCATCTGAGAGGGCTAAGAAAAAGGGGTTTTCTCTGTCTAAGCGATTCGCAGAGGTTACACCAAATAGGAGAACTGAAGCAGCAAAATTTGCTCAATTGTGGAACGAAGTTGTCTGCAGTTTCCGTGAAGAAGATTTCATAAGTGACAGGGAGATGGACCTGATGTTAGTTCCATATTCTTCAGATCCCAGCCTTAACCTAATTCA...

Protein

Download Protein FASTA

1158 aa · TkA05G056260|TK1151|PROTEIN

MLRSRFQSIPGAFNAYLLPSERAKKKGFSLSKRFAEVTPNRRTEAAKFAQLWNEVVCSFREEDFISDREMDLMLVPYSSDPSLNLIQWPPYLLASKVPIALDMAVQFRSKDADLWKRICADEYMKCAVTECYESFKLVLNALVIGHTEKRIIGIIIKEVESSISKNTFLTNFRMGSLPTLRNQFVKLVESLKEADESKHNTVVLLLQDMLEVVTRDMMVNEIRELVELGHGSKDSGTQLFEKAMDSKPAIAFPPPVTAQW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G056260`
TK1151 ID	TkA05G056260
OH-1004 ID	LXL04_019494
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 58.793 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G056260

Location Chr05:14960106-14976834 (-)

Description Similar to CALS5: Callose synthase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g13680`	Required for the formation of the callose wall separating the tetraspores (interstitial wall) and surrounding the pollen mother cells (peripheral wall).	Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02379.x Callose (beta-1,3 glucan) is essential for Arabidopsis pollen wall patterning, but not tube growth.2005 · DOI: 10.1186/1471-2229-5-22
`At5g13000`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At1g05570`	Involved in callose synthesis at the forming cell plate during cytokinesis.	An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation.2003 · DOI: 10.1105/tpc.016097
`At2g31960`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At1g06490`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019494 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006075 (1->3)-beta-D-glucan biosynthetic process Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0009555 pollen development Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0010233 phloem transport Biological Process

GO:0071555 cell wall organization Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0080165 callose deposition in phloem sieve plate Biological Process

GO:0000148 1,3-beta-D-glucan synthase complex Cellular Component

KEGG gene cross-reference

ath:AT1G05570

ath:AT1G06490

ath:AT2G13680

ath:AT2G31960

ath:AT5G13000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.563

Rank 1 · TkA05G056260 · TK1151

Endoplasmic reticulum0.234

Rank 2 · TkA05G056260 · TK1151

Golgi apparatus0.166

Rank 3 · TkA05G056260 · TK1151

Cytoplasm0.136

Rank 4 · TkA05G056260 · TK1151

Lysosome / Vacuole0.081

Rank 5 · TkA05G056260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25968CALS189-273 aa

PF02364Glucan_synthase280-364 aa

PF02364Glucan_synthase371-974 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G056260	`PF25968`	CALS1	89	273	5.1e-65	219.3
TkA05G056260	`PF02364`	Glucan_synthase	280	364	1.2e-238	795.2
TkA05G056260	`PF02364`	Glucan_synthase	371	974	1.2e-238	795.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3B724`	Arabidopsis thaliana	sp\|Q3B724\|CALS5_ARATH Callose synthase 5	80.800%	Swiss-Prot	High
`Q9LXT9`	Arabidopsis thaliana	sp\|Q9LXT9\|CALS3_ARATH Callose synthase 3	64.000%	Swiss-Prot	High
`Q9AUE0`	Arabidopsis thaliana	sp\|Q9AUE0\|CALS1_ARATH Callose synthase 1	62.300%	Swiss-Prot	High
`Q9SL03`	Arabidopsis thaliana	sp\|Q9SL03\|CALS2_ARATH Callose synthase 2	62.400%	Swiss-Prot	High
`Q9SHJ3`	Arabidopsis thaliana	sp\|Q9SHJ3\|CALS7_ARATH Callose synthase 7	61.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card