TkA05G051520 | RubberDandelionOmics

Gene overview

TkA05G051520

Reference: TK1151 Chr: Chr05 Coordinates: 13716570-13718567 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1200 bp · TkA05G051520|TK1151|cDNA

GGTTTGGTGAGGTTTTAGTCGTCCCTCTCCCGCCTGTACGTCGATTCTTCTCTAAACCCACAAATCCTCCCGCTCGAACTCATTCTCTTTCAAAGTGCGGCTACCTAGGGTTTCAGACAATTTCTTCTCCAAAAAACGCGACCGAATACCTTTCTTCTCCTCTCATCTCCCGAGCATCTCAAGTCCGCCTGAAATAGAGGGTGCAGCGGCCCTATCTTCCATCTAGGAAGCATTTACGACTATTATATGCGTCTCCATTG...

CDS

Download CDS FASTA

777 bp · TkA05G051520|TK1151|CDS

ATGCGACTAGGGTTTGTAGAGGTTTTCACTTTCGATTTTGGCACAGAAATGAAAAACCGGGAGAGGCAGGAGGAATACGATGCACCTTCCTTTAATATCACCGATTTCGATTCTCCTTCTGAAATGAAAAACCTAGAGCTGAAGGAGGAATACGATGATCCTTCATTTAATATCACCGATTTCGATTCTACTTCTGATGCATCAACAGGCACCCGCACTAAGGTCGTCAGTGATGGTAAAATCGTGTCTGTGGAGGCCTT...

Protein

Download Protein FASTA

258 aa · TkA05G051520|TK1151|PROTEIN

MRLGFVEVFTFDFGTEMKNRERQEEYDAPSFNITDFDSPSEMKNLELKEEYDDPSFNITDFDSTSDASTGTRTKVVSDGKIVSVEALEQADDIENSASHEKITSSEDELPAADQRESSASIGGPVTSHMENLTSEHVSVKRQKVKIQGRRRLCKVAVKDEEEEKEDEIFQDVESDFTAAVSDFDSPVPEKYESAILHGNDKSAFDRDKRIGSAVAQDLRNCVQPYFLRRLKNEVFRGDSGTNTAKLSKKNEIIVWLNV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G051520`
TK1151 ID	TkA05G051520
OH-1004 ID	LXL04_031319
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G051520

Location Chr05:13716570-13718567 (-)

Description Similar to CHR24: Protein CHROMATIN REMODELING 24

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63950`	DNA helicase that acts as an essential component of the spindle assembly checkpoint (By similarity).	A transient assay for recombination demonstrates that Arabidopsis SNM1 and XRCC3 enhance non-homologous recombination.2011 · DOI: 10.4238/vol10-3gmr1347

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0692750`	DNA helicase that acts as an essential component of the spindle assembly checkpoint (By similarity).	Rice SNF2 family helicase ENL1 is essential for syncytial endosperm development.2015 · DOI: 10.1111/tpj.12705

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031319 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0010965 regulation of mitotic sister chromatid separation Biological Process

GO:0045951 positive regulation of mitotic recombination Biological Process

GO:0051301 cell division Biological Process

GO:2000014 regulation of endosperm development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0004386 helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G63950

dosa:Os04g0692750

osa:9266414

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.718

Rank 1 · TkA05G051520 · TK1151

Cytoplasm0.299

Rank 2 · TkA05G051520 · TK1151

Cell membrane0.046

Rank 3 · TkA05G051520 · TK1151

Mitochondrion0.046

Rank 4 · TkA05G051520 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA05G051520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16663MAGI_u162-92 aa

PF16663MAGI_u1160-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G051520	`PF16663`	MAGI_u1	62	92	0.12	13.0
TkA05G051520	`PF16663`	MAGI_u1	160	184	0.12	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W103`	Arabidopsis thaliana	sp\|Q8W103\|CHR24_ARATH Protein CHROMATIN REMODELING 24	61.400%	Swiss-Prot	Low
`A0A0P0WGX7`	Oryza sativa subsp. japonica	sp\|A0A0P0WGX7\|ENL1_ORYSJ SNF2 domain-containing protein ENL1	60.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card