TkA05G042610 | RubberDandelionOmics

Gene overview

TkA05G042610

Reference: TK1151 Chr: Chr05 Coordinates: 11335783-11338249 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1768 bp · TkA05G042610|TK1151|cDNA

TGGTATTCAATGAACACTGGATACAAAATCTTTACCTTCTTACATACAAAAAAGAAATATTACTCTCTACTTTCTTACATACAAAAAAGAAATATTAGTGATACATCAACAAAAACAAATGGTTGTTACTCTAGAGAATCATTAATTAACTCATTATCCTAACAACTATATTCAACTTTGACCTTTTAAACTTTAACCATCCAATATTATTTTTTTTCCCCAAATAATGAAAATAGCCACAAACAATAAACGTAAGAGCA...

CDS

Download CDS FASTA

942 bp · TkA05G042610|TK1151|CDS

ATGGCTCCGGCAGCAGTTGATTTTGATGGGTCTTCGTCTTCATTCAAGAGAGTTTGTGTAATGGATGCCGGTGGAAGTTTAGGATCTGCACTTGTGCACCGTCTTCTTCAAAGAGGTTACTTCGTTCATGCTGCAATTCACAGCCATGTGGAGATGCAGTCTATGGAAAGAACGATTGCAGACAAGAAGAAATTGAAAGTGTTTCACACAGACCCGTTGGATTATCACAGTATAGTGGAAGCTTTGGAAGGATGTTATGG...

Protein

Download Protein FASTA

313 aa · TkA05G042610|TK1151|PROTEIN

MAPAAVDFDGSSSSFKRVCVMDAGGSLGSALVHRLLQRGYFVHAAIHSHVEMQSMERTIADKKKLKVFHTDPLDYHSIVEALEGCYGLFYSFEAPSDQPSYDELMTEMEVRAAHNVLEACAQTETIDKVVFTSSATAVIWRDPSDSTPSSSDFDERNWSNVNFCRKFKLWHGLSKTLAEKTAWALAMDRGLSMVSINAGLLLSPDLTITHPYLKGAAEMYKDGVFVTVDLKFLVDSHICVFEESSAYGRYLCFNHVINSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G042610`
TK1151 ID	TkA05G042610
OH-1004 ID	LXL04_019315
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G042610

Location Chr05:11335783-11338249 (-)

Description Similar to SNL6: Cinnamoyl-CoA reductase-like SNL6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42800`	Bifunctional enzyme involved in flavonoid metabolism.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019315 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009555 pollen development Biological Process

GO:0009699 phenylpropanoid biosynthetic process Biological Process

GO:0009809 lignin biosynthetic process Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0010597 green leaf volatile biosynthetic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048316 seed development Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G35420

dosa:Os01g0639200

mtr:25487973

osa:4326581

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.494

Rank 1 · TkA05G042610 · TK1151

Nucleus0.413

Rank 2 · TkA05G042610 · TK1151

Cell membrane0.091

Rank 3 · TkA05G042610 · TK1151

Lysosome / Vacuole0.066

Rank 4 · TkA05G042610 · TK1151

Plastid0.063

Rank 5 · TkA05G042610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368NmrA16-137 aa

PF00106adh_short16-84 aa

PF02719Polysacc_synt_218-138 aa

PF010733Beta_HSD20-139 aa

PF01370Epimerase23-205 aa

PF13460NAD_binding_1023-137 aa

PF07993NAD_binding_424-71 aa

PF16363GDP_Man_Dehyd25-136 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G042610	`PF05368`	NmrA	16	137	2.5e-07	31.3
TkA05G042610	`PF00106`	adh_short	16	84	0.23	11.7
TkA05G042610	`PF02719`	Polysacc_synt_2	18	138	0.028	14.3
TkA05G042610	`PF01073`	3Beta_HSD	20	139	3.5e-08	33.6
TkA05G042610	`PF01370`	Epimerase	23	205	1.1e-08	35.5
TkA05G042610	`PF13460`	NAD_binding_10	23	137	5.5e-08	33.6
TkA05G042610	`PF07993`	NAD_binding_4	24	71	0.00019	21.4
TkA05G042610	`PF16363`	GDP_Man_Dehyd	25	136	4.2e-05	23.9
TkA05G042610	`PF07993`	NAD_binding_4	105	201	0.00019	21.4
TkA05G042610	`PF19042`	CBP110	252	292	0.027	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51102`	Arabidopsis thaliana	sp\|P51102\|DFRA_ARATH Dihydroflavonol 4-reductase	31.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card