TkA05G036060 | RubberDandelionOmics

Gene overview

TkA05G036060

Reference: TK1151 Chr: Chr05 Coordinates: 9733989-9734483 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

495 bp · TkA05G036060|TK1151|cDNA

ATGGTGAAATCACTTCTTAAATCTCTGTTTAACAAATCCGCTTGTGGTTCAGATGCTAAACAACCAGTAATCGAACAAGATTCTGATTCTGATAAACATTTCTTGACCAAATACCTAAAAGTCAACACGAAACCTAGTTTGGGGCAAACGTCAAAATACCCGACATTGGGAAACGTTTTAAAGGGTATTGACGATGAGGGAAATGAAGATAGTTGCAGCAATCGGAAGTCTTTTTCAAAGGCGATTAAGAGAAAATGCTC...

CDS

Download CDS FASTA

495 bp · TkA05G036060|TK1151|CDS

ATGGTGAAATCACTTCTTAAATCTCTGTTTAACAAATCCGCTTGTGGTTCAGATGCTAAACAACCAGTAATCGAACAAGATTCTGATTCTGATAAACATTTCTTGACCAAATACCTAAAAGTCAACACGAAACCTAGTTTGGGGCAAACGTCAAAATACCCGACATTGGGAAACGTTTTAAAGGGTATTGACGATGAGGGAAATGAAGATAGTTGCAGCAATCGGAAGTCTTTTTCAAAGGCGATTAAGAGAAAATGCTC...

Protein

Download Protein FASTA

164 aa · TkA05G036060|TK1151|PROTEIN

MVKSLLKSLFNKSACGSDAKQPVIEQDSDSDKHFLTKYLKVNTKPSLGQTSKYPTLGNVLKGIDDEGNEDSCSNRKSFSKAIKRKCSPSSTSSSSSSSSSSSSSSSFSYSNGVYELCKRNSSADSELEGSIEAAIDHCKKSQQVLNQCHGFGLFFCFFSFVLWR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G036060`
TK1151 ID	TkA05G036060
OH-1004 ID	LXL04_027319
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	89.500
Protein coverage (%)	TK1151 98.780 / OH-1004 87.978 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G036060`
Location	Chr05:9733989-9734483 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_027319` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.410

Rank 1 · TkA05G036060 · TK1151

Cytoplasm0.352

Rank 2 · TkA05G036060 · TK1151

Cell membrane0.260

Rank 3 · TkA05G036060 · TK1151

Endoplasmic reticulum0.113

Rank 4 · TkA05G036060 · TK1151

Mitochondrion0.063

Rank 5 · TkA05G036060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08474MYT113-53 aa

PF09726Macoilin50-118 aa

PF04637Herpes_pp8566-108 aa

PF30675FAM13368-105 aa

PF04415DUF51568-111 aa

PF10500SR-2573-112 aa

PF08474MYT174-113 aa

PF27961CSNKA2IP81-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G036060	`PF08474`	MYT1	13	53	1.1	9.9
TkA05G036060	`PF09726`	Macoilin	50	118	6.7	5.9
TkA05G036060	`PF04637`	Herpes_pp85	66	108	1.9	7.4
TkA05G036060	`PF30675`	FAM133	68	105	0.9	10.5
TkA05G036060	`PF04415`	DUF515	68	111	1.6	7.8
TkA05G036060	`PF10500`	SR-25	73	112	0.0012	19.2
TkA05G036060	`PF08474`	MYT1	74	113	1.1	9.9
TkA05G036060	`PF27961`	CSNKA2IP	81	115	0.87	9.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card