TkA05G035090 | RubberDandelionOmics

Gene overview

TkA05G035090

Reference: TK1151 Chr: Chr05 Coordinates: 9491908-9493852 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1310 bp · TkA05G035090|TK1151|cDNA

GTGAAGTTTCCCAATTTTATGAAGATGAAGAACAACCAACCAATAGAATACAATCAATCTCATAGATTGCAGAGCCAAAAGCAAATACCCAAGTATGCTACCAATCATAACATAATCTTCATCAGATTATCTATCCCAAACAATTCAACTAGAAATGGCTTTGTTGAGACTTCCATCCCAATTGCCAATACCCCTTCACTCAGCTTCCACTTCCGCCATCTCTCAATCCACCCACAGCCACTCCGTCGCCTTCCCCCGTC...

CDS

Download CDS FASTA

822 bp · TkA05G035090|TK1151|CDS

ATGGCTTTGTTGAGACTTCCATCCCAATTGCCAATACCCCTTCACTCAGCTTCCACTTCCGCCATCTCTCAATCCACCCACAGCCACTCCGTCGCCTTCCCCCGTCACCGGAAACAGTACCCGCGCCACCGCAGTACAATTACAACCAGAAGCCGCGTGGTTGTCGGTGCTAACAAGGAAGATACCGAGACTGAATTAAATTTCCCCGGAGAATTAAACACCAATTCTACTTCTGCAACTGCAACCACAACTGATGAAGA...

Protein

Download Protein FASTA

273 aa · TkA05G035090|TK1151|PROTEIN

MALLRLPSQLPIPLHSASTSAISQSTHSHSVAFPRHRKQYPRHRSTITTRSRVVVGANKEDTETELNFPGELNTNSTSATATTTDEDDDDDFEEDPDPQDLEYISQIKRVLELLKKNRDMMFSEVKLTIMIEDPREVERKRLLGIDDADTPTREELADVLEEVNEGKIPRDKFALQMLAEEMVQWPNLEVESKKKGKKKSLYAKATDTGIDPEVAAKKLNIDWDTAAEIEDVDTSDETDLPSAVGFGALYIVTAFPVIIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G035090`
TK1151 ID	TkA05G035090
OH-1004 ID	LXL04_019262
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G035090

Location Chr05:9491908-9493852 (-)

Description Similar to Ycf3-interacting protein 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44650`	Nuclear genome-encoded factor that participates in photosystem I (PSI) biogenesis.	Y3IP1, a nucleus-encoded thylakoid protein, cooperates with the plastid-encoded Ycf3 protein in photosystem I assembly of tobacco and Arabidopsis.2010 · DOI: 10.1105/tpc.110.073908 A novel chloroplast protein, CEST induces tolerance to multiple environmental stresses and reduces photooxidative damage in transgenic Arabidopsis.2011 · DOI: 10.1093/jxb/erq290

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8AAV3`	Involved in light-induced chloroplast development and growth.	No verified direct reference in this release
`Os01g0798500`	Involved in light-induced chloroplast development and growth.	A novel chloroplast protein, CEST induces tolerance to multiple environmental stresses and reduces photooxidative damage in transgenic Arabidopsis.2011 · DOI: 10.1093/jxb/erq290

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019262 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010286 heat acclimation Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0048564 photosystem I assembly Biological Process

GO:0080183 response to photooxidative stress Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009579 thylakoid Cellular Component

KEGG gene cross-reference

ath:AT5G44650

dosa:Os01g0798500

nta:107817932

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.984

Rank 1 · TkA05G035090 · TK1151

Nucleus0.023

Rank 2 · TkA05G035090 · TK1151

Mitochondrion0.018

Rank 3 · TkA05G035090 · TK1151

Cytoplasm0.014

Rank 4 · TkA05G035090 · TK1151

Cell membrane0.012

Rank 5 · TkA05G035090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30988Y3IP1_CEST_N97-183 aa

PF11491DUF3213145-187 aa

PF28637Y3IP1_CEST_C248-273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G035090	`PF30988`	Y3IP1_CEST_N	97	183	1.1e-46	157.6
TkA05G035090	`PF11491`	DUF3213	145	187	0.12	13.3
TkA05G035090	`PF28637`	Y3IP1_CEST_C	248	273	7.8e-13	48.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU01`	Arabidopsis thaliana	sp\|Q9LU01\|Y3IP1_ARATH Ycf3-interacting protein 1, chloroplastic	68.200%	Swiss-Prot	Medium
`B8AAV3`	Oryza sativa subsp. indica	sp\|B8AAV3\|CEST_ORYSI Protein CHLOROPLAST ENHANCING STRESS TOLERANCE, chloroplastic	70.200%	Swiss-Prot	Medium
`Q5VQK9`	Oryza sativa subsp. japonica	sp\|Q5VQK9\|CEST_ORYSJ Protein CHLOROPLAST ENHANCING STRESS TOLERANCE, chloroplastic	70.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card