TkA05G031220 | RubberDandelionOmics

Gene overview

TkA05G031220

Reference: TK1151 Chr: Chr05 Coordinates: 8446704-8447506 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

731 bp · TkA05G031220|TK1151|cDNA

TTAGAATCTTGAATCATAATCACAAAATGGTATAGAATCAGATAAGCGTTATCATTCATCATAAACTCGTACTCTTCTTGCATATTTCTGATTTAACCTTGAGAAAAATGACGAGCGGAGAAGGCGGAGCACCGGCAATCGGAATAGATTTGGGAACCACACACTCTTGCGTTGCTGTATGGAAACACGGTCGAATCGACATCATAGCCAACGACGAAGGGAATCGAACAACGCCATCTTGCGTTGCTTTTACTAATGCT...

CDS

Download CDS FASTA

624 bp · TkA05G031220|TK1151|CDS

ATGACGAGCGGAGAAGGCGGAGCACCGGCAATCGGAATAGATTTGGGAACCACACACTCTTGCGTTGCTGTATGGAAACACGGTCGAATCGACATCATAGCCAACGACGAAGGGAATCGAACAACGCCATCTTGCGTTGCTTTTACTAATGCTCACCGGCTAGTTGGTGATGCAGCCAAGAACCAAATCGCAAACAACCCTGCTAATACTATCTTCAATGCAAAGAGGTTGATCGGCAGGAGGTTCAGTGAAGTCACTGT...

Protein

Download Protein FASTA

208 aa · TkA05G031220|TK1151|PROTEIN

MTSGEGGAPAIGIDLGTTHSCVAVWKHGRIDIIANDEGNRTTPSCVAFTNAHRLVGDAAKNQIANNPANTIFNAKRLIGRRFSEVTVQEEIKLLPFRVIQGPNDMPKVLVSHKDNEQQFSTEEISSMILAKMKEVAEAYVGSTVKNAVITVPAYFNNHQRQATKDAATIAGLNVLRLINEPTAAAIAYGIDNMLGITGKRNVVVFDLG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G031220`
TK1151 ID	TkA05G031220
OH-1004 ID	LXL04_019219
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	84.100
Protein coverage (%)	TK1151 100.000 / OH-1004 28.032 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G031220

Location Chr05:8446704-8447506 (-)

Description Similar to HSP70: Heat shock cognate 70 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02500`	In cooperation with other chaperones, Hsp70s are key components that facilitate folding of de novo synthesized proteins, assist translocation of precursor proteins into organelles, and are responsible for degradation of damaged protein under stress conditions (Probable).	Physiological and molecular assessment of altered expression of Hsc70-1 in Arabidopsis. Evidence for pleiotropic consequences.2003 · DOI: 10.1104/pp.102.019398 Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses.2007 · DOI: 10.1105/tpc.107.051896 WPP-domain proteins mimic the activity of the HSC70-1 chaperone in preventing mistargeting of RanGAP1-anchoring protein WIT1.2009 · DOI: 10.1104/pp.109.143404 The cytosolic/nuclear HSC70 and HSP90 molecular chaperones are important for stomatal closure and modulate abscisic acid-dependent physiological responses in Arabidopsis.2011 · DOI: 10.1104/pp.111.174425
`At1g56410`	Heat shock 70 kDa protein 18.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019219 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006457 protein folding Biological Process

GO:0006950 response to stress Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009408 response to heat Biological Process

GO:0009615 response to virus Biological Process

GO:0009617 response to bacterium Biological Process

GO:0010187 negative regulation of seed germination Biological Process

GO:0010286 heat acclimation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042026 protein refolding Biological Process

GO:0042742 defense response to bacterium Biological Process

KEGG gene cross-reference

ath:AT3G12580

ath:AT5G02490

ath:AT5G02500

sly:101247772

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.617

Rank 1 · TkA05G031220 · TK1151

Nucleus0.268

Rank 2 · TkA05G031220 · TK1151

Mitochondrion0.201

Rank 3 · TkA05G031220 · TK1151

Cell membrane0.079

Rank 4 · TkA05G031220 · TK1151

Extracellular0.051

Rank 5 · TkA05G031220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00012HSP7010-208 aa

PF06723MreB_Mbl10-69 aa

PF14450FtsA12-146 aa

PF06723MreB_Mbl125-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G031220	`PF00012`	HSP70	10	208	9.6e-90	302.2
TkA05G031220	`PF06723`	MreB_Mbl	10	69	2.1e-07	30.8
TkA05G031220	`PF14450`	FtsA	12	146	0.032	15.3
TkA05G031220	`PF06723`	MreB_Mbl	125	191	2.1e-07	30.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P22953`	Arabidopsis thaliana	sp\|P22953\|HS701_ARATH Heat shock 70 kDa protein 1	66.500%	Swiss-Prot	High
`Q9C7X7`	Arabidopsis thaliana	sp\|Q9C7X7\|HSP7N_ARATH Heat shock 70 kDa protein 18	66.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card