TkA05G026720 | RubberDandelionOmics

Gene overview

TkA05G026720

Reference: TK1151 Chr: Chr05 Coordinates: 7263344-7265838 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1580 bp · TkA05G026720|TK1151|cDNA

CATATGCACATGATAACCACCCCCTTACGGGCATATTATTGGAGATGTCGGAAATGGTCGATGTCAAAGTCAAGACCCTTCTACTGTCAAATATGATGCTCAAATAATCACCTCCTTCTCTCTCCAGTCTCCAAGATGATTCAGAGATGGCCACACAAGAAGAAAACCCAACTTCCCCTCATAGCATTGCTCTGCTTCCTCTTCGTGCTCTGTACTATTTTCTACAACGAACGTCGATTTCTACAAATCCACCGGAAAGA...

CDS

Download CDS FASTA

1350 bp · TkA05G026720|TK1151|CDS

ATGATTCAGAGATGGCCACACAAGAAGAAAACCCAACTTCCCCTCATAGCATTGCTCTGCTTCCTCTTCGTGCTCTGTACTATTTTCTACAACGAACGTCGATTTCTACAAATCCACCGGAAAGAAAATCGGAAAGGAGATCATATTGGTACTCCCAATGATGTCAAGAAAACAATTTCGTTCCTGAATAGCAGCCGCCCAAAAGTTCCTCCAGTGGCTTTAGATAGATTCAGTACCTGCAAGTCTACAGTTAAGTACAG...

Protein

Download Protein FASTA

449 aa · TkA05G026720|TK1151|PROTEIN

MIQRWPHKKKTQLPLIALLCFLFVLCTIFYNERRFLQIHRKENRKGDHIGTPNDVKKTISFLNSSRPKVPPVALDRFSTCKSTVKYSGQKARWDINSIHSDKQQEETKDSCNIFSGKWVLDDTSYPLYKESDCPYMSDQLACHKHGRPDLEYQYWRWQPHGCNLKRWNASEMWEKLRDKRLMFVGDSLNRGQWISMLCLLESTIPPDKKSITPNAPLTIFRAEEYNATVEFQWAPLVVESNSDDPVNHRLDERIMRPDSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G026720`
TK1151 ID	TkA05G026720
OH-1004 ID	LXL04_019186
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G026720

Location Chr05:7263344-7265838 (+)

Description Similar to TBL35: Protein trichome birefringence-like 35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g01620`	May act as a bridging protein that binds pectin and other cell wall polysaccharides.	No verified direct reference in this release
`At2g38320`	May act as a bridging protein that binds pectin and other cell wall polysaccharides.	No verified direct reference in this release
`At2g40320`	Probable xylan acetyltransferase that plays a role in xylan acetylation and normal deposition of secondary cell walls.	Mutations of Arabidopsis TBL32 and TBL33 Affect Xylan Acetylation and Secondary Wall Deposition.2016 · DOI: 10.1371/journal.pone.0146460

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0817500`	Xylan acetyltransferase required for 2-O- and 3-O-monoacetylation of xylosyl residues in xylan.	Biochemical characterization of rice xylan O-acetyltransferases.2018 · DOI: 10.1007/s00425-018-2882-1
`Os03g0817900`	Probable xylan acetyltransferase required for 2-O- and 3-O-monoacetylation of xylosyl residues in xylan.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019186 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0016413 O-acetyltransferase activity Molecular Function

GO:1990538 xylan O-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G38320

ath:AT2G40320

ath:AT5G01620

dosa:Os03g0817500

dosa:Os03g0817900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.617

Rank 1 · TkA05G026720 · TK1151

Cell membrane0.090

Rank 2 · TkA05G026720 · TK1151

Endoplasmic reticulum0.073

Rank 3 · TkA05G026720 · TK1151

Extracellular0.058

Rank 4 · TkA05G026720 · TK1151

Cytoplasm0.035

Rank 5 · TkA05G026720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14416PMR5N110-163 aa

PF24536NXPE4_C157-234 aa

PF13839PC-Esterase165-447 aa

PF14416PMR5N315-321 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G026720	`PF14416`	PMR5N	110	163	1.1e-23	84.0
TkA05G026720	`PF24536`	NXPE4_C	157	234	0.00029	21.2
TkA05G026720	`PF13839`	PC-Esterase	165	447	1.8e-83	281.5
TkA05G026720	`PF14416`	PMR5N	315	321	1.1e-23	84.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXQ1`	Arabidopsis thaliana	sp\|Q8RXQ1\|TBL35_ARATH Protein trichome birefringence-like 35	64.300%	Swiss-Prot	High
`O80919`	Arabidopsis thaliana	sp\|O80919\|TBL34_ARATH Protein trichome birefringence-like 34	53.200%	Swiss-Prot	High
`F4IH21`	Arabidopsis thaliana	sp\|F4IH21\|TBL33_ARATH Protein trichome birefringence-like 33	49.300%	Swiss-Prot	Medium
`Q84TV3`	Oryza sativa subsp. japonica	sp\|Q84TV3\|XOATE_ORYSJ Xylan O-acetyltransferase 14	49.000%	Swiss-Prot	Medium
`Q84TW8`	Oryza sativa subsp. japonica	sp\|Q84TW8\|XOATA_ORYSJ Probable xylan O-acetyltransferase 10	50.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card