TkA05G020860 | RubberDandelionOmics

Gene overview

TkA05G020860

Reference: TK1151 Chr: Chr05 Coordinates: 5715569-5718358 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2213 bp · TkA05G020860|TK1151|cDNA

TCCTTTTTTATTAATATCTATCGAGTCAATGTGGTGTTTCTTTATGGTCTTTAGTCTTTCATGATTGCAGACAGAGTCTTCGAATCTTTAAATTATGGCTCTCATGTTTTCACTTGAGAAGAAAAGGACCGTAAATCCTTTCCCCCCAAATCCAGGGGAAACGGGGAAACTCCAAGCTTCTAAGTCAACTCAAGAATGGCTTCCTTCGTTAGGATTTCAGCATTGTTATGGGCGGATTTATTAGCTGCATTTGCAATGTA...

CDS

Download CDS FASTA

1071 bp · TkA05G020860|TK1151|CDS

ATGGCTTCCTTCGTTAGGATTTCAGCATTGTTATGGGCGGATTTATTAGCTGCATTTGCAATGTACGTGATGATGACCTACTTAACAAATGTATGGAATCTAAGCACTACACACGCTGCTGGTATTATCAACATTTGGGACGGCATCACAGCCTCTTTACCCATTATGTTTGCCTACTTTGTTGACTCCTTCATGAACGACTACTATATGCTTCTTTTTTCTAGCATTTCCCACACTATAGGATTAGGATTACTGTCCAT...

Protein

Download Protein FASTA

356 aa · TkA05G020860|TK1151|PROTEIN

MASFVRISALLWADLLAAFAMYVMMTYLTNVWNLSTTHAAGIINIWDGITASLPIMFAYFVDSFMNDYYMLLFSSISHTIGLGLLSMSTPPVLGPCNEYNEKCIGRTQKILFYTALPLIAVGMAGHVVSLLAFLNLQTNNENQEEGKDMNKDEMKKEKESKIFWQILGLLVVFVVLIVGGIALPYIKPWSIRFGIPAICTLVATISFFTGYSRYKPCKPAEGSPLTTTMRVFVASVRKFSQPLPDPKQLFNEEDARSTSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G020860`
TK1151 ID	TkA05G020860
OH-1004 ID	LXL04_015722
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	31.400
Protein coverage (%)	TK1151 91.292 / OH-1004 57.804 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G020860

Location Chr05:5715569-5718358 (-)

Description Similar to NPF8.3: Protein NRT1/ PTR FAMILY 8.3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38100`	Protein NRT1/ PTR FAMILY 5.5.	No verified direct reference in this release
`At3g54450`	Protein NRT1/ PTR FAMILY 5.4.	No verified direct reference in this release
`At2g02040`	Peptide transporter.	No verified direct reference in this release
`At1g22570`	Protein NRT1/ PTR FAMILY 5.15.	No verified direct reference in this release
`At1g69860`	Putative protein NRT1/ PTR FAMILY 2.14.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015722 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006857 oligopeptide transport Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0015031 protein transport Biological Process

GO:0015833 peptide transport Biological Process

GO:0042938 dipeptide transport Biological Process

GO:0042939 tripeptide transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

KEGG gene cross-reference

ath:AT1G62200

ath:AT2G02020

ath:AT2G02040

ath:AT3G54140

ath:AT5G01180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.837

Rank 1 · TkA05G020860 · TK1151

Cytoplasm0.075

Rank 2 · TkA05G020860 · TK1151

Endoplasmic reticulum0.069

Rank 3 · TkA05G020860 · TK1151

Lysosome / Vacuole0.045

Rank 4 · TkA05G020860 · TK1151

Mitochondrion0.029

Rank 5 · TkA05G020860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29941GspB9-37 aa

PF01529DHHC9-72 aa

PF00854PTR272-330 aa

PF01529DHHC102-178 aa

PF19579FtsL_2105-162 aa

PF31018MARCH_TM_C109-130 aa

PF07331TctB115-178 aa

PF20342DUF6637119-139 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G020860	`PF29941`	GspB	9	37	0.27	12.0
TkA05G020860	`PF01529`	DHHC	9	72	2.2	9.1
TkA05G020860	`PF00854`	PTR2	72	330	2.6e-21	76.7
TkA05G020860	`PF01529`	DHHC	102	178	2.2	9.1
TkA05G020860	`PF19579`	FtsL_2	105	162	0.025	15.2
TkA05G020860	`PF31018`	MARCH_TM_C	109	130	0.0047	18.1
TkA05G020860	`PF07331`	TctB	115	178	0.0042	18.0
TkA05G020860	`PF20342`	DUF6637	119	139	0.0017	19.0
TkA05G020860	`PF31018`	MARCH_TM_C	150	187	0.0047	18.1
TkA05G020860	`PF20342`	DUF6637	153	220	0.0017	19.0
TkA05G020860	`PF29941`	GspB	153	181	0.27	12.0
TkA05G020860	`PF29941`	GspB	240	279	0.27	12.0
TkA05G020860	`PF31018`	MARCH_TM_C	285	318	0.0047	18.1
TkA05G020860	`PF07331`	TctB	291	324	0.0042	18.0
TkA05G020860	`PF01529`	DHHC	301	325	2.2	9.1
TkA05G020860	`PF19579`	FtsL_2	302	344	0.025	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80436`	Arabidopsis thaliana	sp\|O80436\|PTR29_ARATH Protein NRT1/ PTR FAMILY 5.5	39.300%	Swiss-Prot	Medium
`Q9M1I2`	Arabidopsis thaliana	sp\|Q9M1I2\|PTR46_ARATH Protein NRT1/ PTR FAMILY 5.4	28.800%	Swiss-Prot	Low
`P46032`	Arabidopsis thaliana	sp\|P46032\|PTR2_ARATH Protein NRT1/ PTR FAMILY 8.3	29.900%	Swiss-Prot	Low
`Q9SK99`	Arabidopsis thaliana	sp\|Q9SK99\|PTR11_ARATH Protein NRT1/ PTR FAMILY 5.15	26.700%	Swiss-Prot	Low
`Q9CAR9`	Arabidopsis thaliana	sp\|Q9CAR9\|PTR20_ARATH Putative protein NRT1/ PTR FAMILY 2.14	25.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card