TkA05G010510 | RubberDandelionOmics

Gene overview

TkA05G010510

Reference: TK1151 Chr: Chr05 Coordinates: 3014114-3015520 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

878 bp · TkA05G010510|TK1151|cDNA

GTAAAGTTCCGCTATACAATTTTGCTAGAGCAGCTACACAGTTTTCCCTCGTCGCCGACTTCGTCATTAGCAGCGCCGAGAAACCCTAATTTACTTCTAGAAAAGATGTCGACGGCGTTGACGGAGGAAGATATCAAGAGGCTATATAGAATAAGGAAAACAGTGATGGAGATGTTGAAGGACAGGAATTATTTGGTAGGAGATTTCGAGCTTGAGATGGATAGAAGGCAGTTTATTCAGAAGTATGGAGATAACATGAA...

CDS

Download CDS FASTA

732 bp · TkA05G010510|TK1151|CDS

GTAAAGTTCCGCTATACAATTTTGCTAGAGCAGCTACACAGTTTTCCCTCGTCGCCGACTTCGTCATTAGCAGCGCCGAGAAACCCTAATTTACTTCTAGAAAAGATGTCGACGGCGTTGACGGAGGAAGATATCAAGAGGCTATATAGAATAAGGAAAACAGTGATGGAGATGTTGAAGGACAGGAATTATTTGGTAGGAGATTTCGAGCTTGAGATGGATAGAAGGCAGTTTATTCAGAAGTATGGAGATAACATGAA...

Protein

Download Protein FASTA

243 aa · TkA05G010510|TK1151|PROTEIN

VKFRYTILLEQLHSFPSSPTSSLAAPRNPNLLLEKMSTALTEEDIKRLYRIRKTVMEMLKDRNYLVGDFELEMDRRQFIQKYGDNMKREDLVISKSLKNDSSEQIYVFFPDEAKVGVKTIKNYINRMKSENVTRGILVVQQNLTPFARTCISEISTKFHLEVFQEAELLVNVKNHVLVPEHQVLANEEKKTLLERYTVKETQLPRIQVTDPVARYYGLKRGQVVKIIRPSETAGRYVTYRYVV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G010510`
TK1151 ID	TkA05G010510
OH-1004 ID	LXL04_010907
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	36.100
Protein coverage (%)	TK1151 82.716 / OH-1004 86.580 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G010510

Location Chr05:3014114-3015520 (+)

Description Similar to NRPE5C: DNA-directed RNA polymerase V subunit 5C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22320`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010907 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006362 transcription elongation by RNA polymerase I Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0042797 tRNA transcription by RNA polymerase III Biological Process

GO:0000418 RNA polymerase IV complex Cellular Component

GO:0000419 RNA polymerase V complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005665 RNA polymerase II, core complex Cellular Component

GO:0005666 RNA polymerase III complex Cellular Component

GO:0005736 RNA polymerase I complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003899 DNA-directed RNA polymerase activity Molecular Function

KEGG gene cross-reference

ath:AT2G41340

ath:AT3G22320

ath:AT3G54490

ath:AT3G57080

cbr:CBG_12745

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.714

Rank 1 · TkA05G010510 · TK1151

Cytoplasm0.302

Rank 2 · TkA05G010510 · TK1151

Mitochondrion0.058

Rank 3 · TkA05G010510 · TK1151

Cell membrane0.033

Rank 4 · TkA05G010510 · TK1151

Endoplasmic reticulum0.026

Rank 5 · TkA05G010510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01191RNA_pol_Rpb5_C40-50 aa

PF03871RNA_pol_Rpb5_N42-127 aa

PF29388F07F6_middle42-125 aa

PF22896OB_RNR_1st60-105 aa

PF04471Mrr_cat86-155 aa

PF22722NA-iREase190-168 aa

PF22896OB_RNR_1st115-132 aa

PF29388F07F6_middle163-186 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G010510	`PF01191`	RNA_pol_Rpb5_C	40	50	5.5e-36	122.9
TkA05G010510	`PF03871`	RNA_pol_Rpb5_N	42	127	1.2e-30	106.7
TkA05G010510	`PF29388`	F07F6_middle	42	125	0.096	13.5
TkA05G010510	`PF22896`	OB_RNR_1st	60	105	0.031	15.2
TkA05G010510	`PF04471`	Mrr_cat	86	155	0.0036	18.1
TkA05G010510	`PF22722`	NA-iREase1	90	168	0.062	14.0
TkA05G010510	`PF22896`	OB_RNR_1st	115	132	0.031	15.2
TkA05G010510	`PF29388`	F07F6_middle	163	186	0.096	13.5
TkA05G010510	`PF01191`	RNA_pol_Rpb5_C	170	242	5.5e-36	122.9
TkA05G010510	`PF04471`	Mrr_cat	199	236	0.0036	18.1
TkA05G010510	`PF22722`	NA-iREase1	199	233	0.062	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81098`	Arabidopsis thaliana	sp\|O81098\|RPB5A_ARATH DNA-directed RNA polymerases II and IV subunit 5A	80.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card