TkA05G009870 | RubberDandelionOmics

Gene overview

TkA05G009870

Reference: TK1151 Chr: Chr05 Coordinates: 2858900-2873639 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2501 bp · TkA05G009870|TK1151|cDNA

GTCAAGAGCAAGGGTAGTTTAAAGGCCTATTGTGGTGTTTATATAAATTCATGCAAGTATTCTTATTCTCAAGTAATATGAACTTTACACTACTTGCAGGCTAAAAAGGAAAAACATTTAGATGAAACATTAGTGCCATCTGATAAAGATATACCTACTGCTTCAACCGATAATGATGAAACTAATCATGCTGATTCTTCTTCAAAAACTGAAGATAATGAGCAACAAAAAGTTAATGATGTTCCCATGTCTTTATCATC...

CDS

Download CDS FASTA

2154 bp · TkA05G009870|TK1151|CDS

ATGGCTCATTGGCTCAAAGCTGCTGAAGATTTGTTTGAAGTTGTAGATCGAAGGGCAAAGCTTGTAGTTGGAGATGAGTTACCAAATTCTTCACAGCCACCAGCTTCCAATGGACAAGGATCTCGAGCAAAGAGTAAAAAGTCAAGAGCAAGGGCTAAAAAGGAAAAACATTTAGATGAAACATTAGTGCCATCTGATAAAGATATACCTACTGCTTCAACCGATAATGATGAAACTAATCATGCTGATTCTTCTTCAAA...

Protein

Download Protein FASTA

717 aa · TkA05G009870|TK1151|PROTEIN

MAHWLKAAEDLFEVVDRRAKLVVGDELPNSSQPPASNGQGSRAKSKKSRARAKKEKHLDETLVPSDKDIPTASTDNDETNHADSSSKTEDNEQQKVNDVPMSLSSSGDHPQHDTMDSKDPSTAIGEDAPPILNGDTLNRTSSKSGEEISSVPVTLEESESDKSHPIDGGQDVLIKDKGSELVVNKEGSQSLTSDIHSKVNSRKDGNLKIEPQIDEKKNEEDKSVTTTTTTPTKVQDQLESPKKIQDESGSPKKAPDQTGP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G009870`
TK1151 ID	TkA05G009870
OH-1004 ID	LXL04_019032
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G009870

Location Chr05:2858900-2873639 (-)

Description Similar to GC1: Golgin candidate 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19950`	Golgi matrix protein playing a role in tethering of vesicles to Golgi membranes and in maintaining the overall structure of the Golgi apparatus.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0744400`	May be involved in maintaining Golgi structure and in intra-Golgi transport.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019032 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000301 retrograde transport, vesicle recycling within Golgi Biological Process

GO:0007030 Golgi organization Biological Process

GO:0048193 Golgi vesicle transport Biological Process

GO:0000137 Golgi cis cisterna Cellular Component

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

GO:0005801 cis-Golgi network Cellular Component

GO:0016020 membrane Cellular Component

GO:0030663 COPI-coated vesicle membrane Cellular Component

KEGG gene cross-reference

ath:AT2G19950

dosa:Os01g0744400

dre:406720

mmu:27277

rno:299258

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.590

Rank 1 · TkA05G009870 · TK1151

Endoplasmic reticulum0.207

Rank 2 · TkA05G009870 · TK1151

Cytoplasm0.153

Rank 3 · TkA05G009870 · TK1151

Nucleus0.076

Rank 4 · TkA05G009870 · TK1151

Cell membrane0.070

Rank 5 · TkA05G009870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09787Golgin_A578-90 aa

PF09787Golgin_A5275-411 aa

PF06971Put_DNA-bind_N319-336 aa

PF06971Put_DNA-bind_N337-351 aa

PF09787Golgin_A5453-689 aa

PF06971Put_DNA-bind_N688-712 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G009870	`PF09787`	Golgin_A5	78	90	2e-23	84.1
TkA05G009870	`PF09787`	Golgin_A5	275	411	2e-23	84.1
TkA05G009870	`PF06971`	Put_DNA-bind_N	319	336	0.16	12.8
TkA05G009870	`PF06971`	Put_DNA-bind_N	337	351	0.16	12.8
TkA05G009870	`PF09787`	Golgin_A5	453	689	2e-23	84.1
TkA05G009870	`PF06971`	Put_DNA-bind_N	688	712	0.16	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8N9`	Arabidopsis thaliana	sp\|Q8S8N9\|GOGC1_ARATH Golgin candidate 1	53.400%	Swiss-Prot	High
`Q5JLY8`	Oryza sativa subsp. japonica	sp\|Q5JLY8\|GOGA5_ORYSJ Golgin-84	49.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card