TkA05G004820 | RubberDandelionOmics

Gene overview

TkA05G004820

Reference: TK1151 Chr: Chr05 Coordinates: 1409793-1412296 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2179 bp · TkA05G004820|TK1151|cDNA

ATTTGGAAGGATCAAAACCTTTCTCTCTCTCCTCACAGCTGGCACTTAATTTACACACAACCCCCTCTCTTACATTTAAAACCCTTCCCATCTCTCCAAATTAATATTCATTCATTCATTCATTCATATACGCAGACCATTGGGATGTTAATGGTCGATCACTGCATATCAACGACAATGGTTGCATCTCCTTCCCATGGCTGTGTTGAAAAGAAGTACTGGTGGCTAACCAACAAGAAGATCGTTGATAAGTATGTGAG...

CDS

Download CDS FASTA

1785 bp · TkA05G004820|TK1151|CDS

ATTTGGAAGGATCAAAACCTTTCTCTCTCTCCTCACAGCTGGCACTTAATTTACACACAACCCCCTCTCTTACATTTAAAACCCTTCCCATCTCTCCAAATTAATATTCATTCATTCATTCATTCATATACGCAGACCATTGGGATGTTAATGGTCGATCACTGCATATCAACGACAATGGTTGCATCTCCTTCCCATGGCTGTGTTGAAAAGAAGTACTGGTGGCTAACCAACAAGAAGATCGTTGATAAGTATGTGAG...

Protein

Download Protein FASTA

594 aa · TkA05G004820|TK1151|PROTEIN

IWKDQNLSLSPHSWHLIYTQPPLLHLKPFPSLQINIHSFIHSYTQTIGMLMVDHCISTTMVASPSHGCVEKKYWWLTNKKIVDKYVRDARTLISSQQQPDIEAALNLLDAALALSPRFELALELKARSLLYLRRYKEVADMLQDYIPSLKMSSDDSSSSSSSSSSVSSDNNSQSLSRERVKLLSSPDHAETSFKCFSVSDLKKKVRAGLGKNCNKEGQWRYLVLGQACCHLGLMEDAMALLQTGKRLASAAFRRESICWS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G004820`
TK1151 ID	TkA05G004820
OH-1004 ID	LXL04_018938
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 99.832 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G004820`
Location	Chr05:1409793-1412296 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018938` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.514

Rank 1 · TkA05G004820 · TK1151

Cytoplasm0.306

Rank 2 · TkA05G004820 · TK1151

Cell membrane0.094

Rank 3 · TkA05G004820 · TK1151

Plastid0.082

Rank 4 · TkA05G004820 · TK1151

Endoplasmic reticulum0.050

Rank 5 · TkA05G004820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13371TPR_997-127 aa

PF12895ANAPC398-144 aa

PF13428TPR_1499-127 aa

PF00515TPR_1100-118 aa

PF14559TPR_19100-146 aa

PF13181TPR_8100-116 aa

PF07719TPR_2100-117 aa

PF13432TPR_16100-137 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G004820	`PF13371`	TPR_9	97	127	6.6e-05	23.6
TkA05G004820	`PF12895`	ANAPC3	98	144	0.03	15.3
TkA05G004820	`PF13428`	TPR_14	99	127	5.2e-05	24.2
TkA05G004820	`PF00515`	TPR_1	100	118	6.3e-07	29.7
TkA05G004820	`PF14559`	TPR_19	100	146	1.2e-05	26.2
TkA05G004820	`PF13181`	TPR_8	100	116	2.1e-05	25.0
TkA05G004820	`PF07719`	TPR_2	100	117	0.00016	22.3
TkA05G004820	`PF13432`	TPR_16	100	137	0.0046	18.1
TkA05G004820	`PF13414`	TPR_11	100	119	0.012	16.1
TkA05G004820	`PF13424`	TPR_12	102	115	1.4	9.9
TkA05G004820	`PF07719`	TPR_2	121	137	0.00016	22.3
TkA05G004820	`PF13428`	TPR_14	123	145	5.2e-05	24.2
TkA05G004820	`PF27961`	CSNKA2IP	129	180	0.15	12.3
TkA05G004820	`PF14559`	TPR_19	221	244	1.2e-05	26.2
TkA05G004820	`PF13181`	TPR_8	221	244	2.1e-05	25.0
TkA05G004820	`PF13428`	TPR_14	221	242	5.2e-05	24.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card