TkA05G004670 | RubberDandelionOmics

Gene overview

TkA05G004670

Reference: TK1151 Chr: Chr05 Coordinates: 1373396-1375029 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1242 bp · TkA05G004670|TK1151|cDNA

ATAAGATCTTAGCTACCCCTGATAAATTTTGTATTATCATTTTAGTACCTATCATTCAGAGATATAACAATTCTACTCAGAAAGACATAAAGAGTGGGAATTTTGCTTTCCGTTAGTAAGAAAGGAGGTCATATTGATATTTCAACTCATACTACTTAACAAGCAAAGCCAAAGAGAAGTAAGAGGGGGAGTTTATGTAATCCCGACAAACTTTAGTGGCATATTAGCAAACTGCTCACCGGCCCAGGGAAGATTTACGT...

CDS

Download CDS FASTA

507 bp · TkA05G004670|TK1151|CDS

ATGGCTTGGATGACACGATTTCTCACTGCGGTTGCCTTCTTGGCAATCGGAGTCATATTTTCGCCGGAAACGTTCGGATCTAAATCAGCAAAGATCACATCTTTCGTCAAACTTGCACACCTCCTATGTTTCTCCACTGCCTGGGGAGCAGCGCTTTGGGTTACCTTCATCGGCGGCATCATCATGTTCAAGAATTTGCCAAGGCATCAGTTTGGGAATCTGCAAAGCAAGATGTTTCCGGCGTACTTTTTGATGGTTGG...

Protein

Download Protein FASTA

168 aa · TkA05G004670|TK1151|PROTEIN

MAWMTRFLTAVAFLAIGVIFSPETFGSKSAKITSFVKLAHLLCFSTAWGAALWVTFIGGIIMFKNLPRHQFGNLQSKMFPAYFLMVGICCAVTVGCLATHIHGSLLQLLRSISLGFGLCFRLNLTNLFVFTPMTIEMMKQRHKVERESNIGKKLGGQRTRRLQRQTQS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G004670`
TK1151 ID	TkA05G004670
OH-1004 ID	LXL04_018934
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	83.400
Protein coverage (%)	TK1151 92.262 / OH-1004 56.318 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G004670`
Location	Chr05:1373396-1375029 (-)
Description	Similar to tmem205: Transmembrane protein 205
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018934` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016020 membrane Cellular Component
KEGG gene cross-reference	dre:791204 hsa:374882 pon:100171672 xla:444019 xtr:733568 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.411

Rank 1 · TkA05G004670 · TK1151

Endoplasmic reticulum0.352

Rank 2 · TkA05G004670 · TK1151

Cytoplasm0.131

Rank 3 · TkA05G004670 · TK1151

Cell membrane0.092

Rank 4 · TkA05G004670 · TK1151

Nucleus0.087

Rank 5 · TkA05G004670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13664DUF41492-33 aa

PF10190TMEM170A_B7-36 aa

PF24380DUF75368-57 aa

PF13664DUF414942-143 aa

PF10190TMEM170A_B51-99 aa

PF24380DUF753678-100 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G004670	`PF13664`	DUF4149	2	33	1.9e-26	93.0
TkA05G004670	`PF10190`	TMEM170A_B	7	36	0.37	11.9
TkA05G004670	`PF24380`	DUF7536	8	57	1.0	10.1
TkA05G004670	`PF13664`	DUF4149	42	143	1.9e-26	93.0
TkA05G004670	`PF10190`	TMEM170A_B	51	99	0.37	11.9
TkA05G004670	`PF24380`	DUF7536	78	100	1.0	10.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card