TkA04G509400 | RubberDandelionOmics

Gene overview

TkA04G509400

Reference: TK1151 Chr: Chr04 Coordinates: 128687415-128688883 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1381 bp · TkA04G509400|TK1151|cDNA

GCCAGGTCACCTCCTCATTACCCTTCTTTTGTAGTTATTACCAATAATCAATGTCGTCTTCTCTCTCACACTTGTTATAAATCCGTCTCTGTGCTCTCTCACTGCTCACTCCAGTATCCAACTCAACATCGATCGCCATGCAGTCCTCTCTAGTACTCTCTCCACTTCCATCATACATTCCGCCTCTCAAACCCACCACTTTCCGCCGGATTCTCCCACCCTCCGCCGTAGCAGCACCTCCTCTCACCACCACTGTCCGC...

CDS

Download CDS FASTA

1155 bp · TkA04G509400|TK1151|CDS

ATGCAGTCCTCTCTAGTACTCTCTCCACTTCCATCATACATTCCGCCTCTCAAACCCACCACTTTCCGCCGGATTCTCCCACCCTCCGCCGTAGCAGCACCTCCTCTCACCACCACTGTCCGCCGCCAGGCGGTTACTCATTCCATGCCTCCTGAAAAGGTCGATATCTTCAAGTCGCTTGAATCCTGGGCGGCTGAATCCGTCCTCCCGCTCCTGAAACCCGTCGACCAGTGCTGGCAGCCTACCGAATTTCTACCGGT...

Protein

Download Protein FASTA

384 aa · TkA04G509400|TK1151|PROTEIN

MQSSLVLSPLPSYIPPLKPTTFRRILPPSAVAAPPLTTTVRRQAVTHSMPPEKVDIFKSLESWAAESVLPLLKPVDQCWQPTEFLPVSSQPFSEFSDEVRALRDRTSELPDEYFVVLVGDMITEDALPTYQTMINTLDGVRDETGASPNPWAMWTRAWTAEENRHGDLLRTYLYLSGRVDMNMIERTVQYLIGSGMDPGTENNPYLGFVYTSFQERATFVSHGNTARLAKEGGDPVLARICGTIASDEKRHENAYVKIVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G509400`
TK1151 ID	TkA04G509400
OH-1004 ID	LXL04_039153
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G509400

Location Chr04:128687415-128688883 (+)

Description Similar to S-ACP-DES6: Stearoyl-[acyl-carrier-protein] 9-desaturase 6, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g43800`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8A7A3`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release
`Os01g0880800`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039153 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0045300 stearoyl-[ACP] desaturase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G43800

csv:101220831

dosa:Os01g0880800

sot:102577562

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.929

Rank 1 · TkA04G509400 · TK1151

Mitochondrion0.083

Rank 2 · TkA04G509400 · TK1151

Cytoplasm0.060

Rank 3 · TkA04G509400 · TK1151

Nucleus0.037

Rank 4 · TkA04G509400 · TK1151

Peroxisome0.031

Rank 5 · TkA04G509400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03405FA_desaturase_252-378 aa

PF02915Rubrerythrin129-171 aa

PF07618DUF1580137-178 aa

PF02915Rubrerythrin225-257 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G509400	`PF03405`	FA_desaturase_2	52	378	4.3e-155	516.2
TkA04G509400	`PF02915`	Rubrerythrin	129	171	0.0015	19.7
TkA04G509400	`PF07618`	DUF1580	137	178	0.13	12.6
TkA04G509400	`PF02915`	Rubrerythrin	225	257	0.0015	19.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84VY3`	Arabidopsis thaliana	sp\|Q84VY3\|STAD6_ARATH Stearoyl-[acyl-carrier-protein] 9-desaturase 6, chloroplastic	79.300%	Swiss-Prot	High
`B8A7A3`	Oryza sativa subsp. indica	sp\|B8A7A3\|STAD1_ORYSI Stearoyl-[acyl-carrier-protein] 9-desaturase 1, chloroplastic	73.600%	Swiss-Prot	High
`Q8LJJ9`	Oryza sativa subsp. japonica	sp\|Q8LJJ9\|STAD1_ORYSJ Stearoyl-[acyl-carrier-protein] 9-desaturase 1, chloroplastic	73.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card