TkA04G503690 | RubberDandelionOmics

Gene overview

TkA04G503690

Reference: TK1151 Chr: Chr04 Coordinates: 127213274-127216417 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1879 bp · TkA04G503690|TK1151|cDNA

ATGTCGAGCAAGACTTCAACGAGGGAGATTGATCCGTTACTGAAGGATCTCGATGAGAAGAAACTGAGCTTTCGCCGGAACGTGTGGTCACTCGCCGCCGAGCTCAAGGATGTTCGTAGCCGTCTTTCATCCCAAGAAGAATCGTTTGCTAAAGAATCTTCAACCAGACAGGTATGCGAAGCAGAAACAAGAGCTAGAAACATGGAACACGAGATTTGTCGATTGCAGAAGAGTTTAGATGAGAGAAATCTGCAACTTAA...

CDS

Download CDS FASTA

1017 bp · TkA04G503690|TK1151|CDS

ATGTCGAGCAAGACTTCAACGAGGGAGATTGATCCGTTACTGAAGGATCTCGATGAGAAGAAACTGAGCTTTCGCCGGAACGTGTGGTCACTCGCCGCCGAGCTCAAGGATGTTCGTAGCCGTCTTTCATCCCAAGAAGAATCGTTTGCTAAAGAATCTTCAACCAGACAGGTATGCGAAGCAGAAACAAGAGCTAGAAACATGGAACACGAGATTTGTCGATTGCAGAAGAGTTTAGATGAGAGAAATCTGCAACTTAA...

Protein

Download Protein FASTA

338 aa · TkA04G503690|TK1151|PROTEIN

MSSKTSTREIDPLLKDLDEKKLSFRRNVWSLAAELKDVRSRLSSQEESFAKESSTRQVCEAETRARNMEHEICRLQKSLDERNLQLKASSFDAEKYQRELDNLTSQLSSTKATADASAISAKSAQMQCEVLLKELDLKNRSLKEHEARVNHLAHQLDLLQKDLESRESSQKQLKDEVMRVEHDIMEALSKAGENNDCELRKILDEVSPRNLDKMMKLLSAKDEEITKLRDEVRVCLLIGSLKPGSRVSKLEKHRRADQEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G503690`
TK1151 ID	TkA04G503690
OH-1004 ID	LXL04_039091
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G503690

Location Chr04:127213274-127216417 (-)

Description Similar to NEAP2: Nuclear envelope-associated protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26770`	Nuclear envelope-associated protein 2.	No verified direct reference in this release
`At1g09470`	Nuclear envelope-associated protein 3.	No verified direct reference in this release
`At3g05830`	Nuclear envelope-associated protein 1.	No verified direct reference in this release
`At1g09483`	Putative nuclear envelope-associated protein 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039091 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005635 nuclear envelope Cellular Component

GO:0005637 nuclear inner membrane Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G09470

ath:AT1G09483

ath:AT3G05830

ath:AT5G26770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.346

Rank 1 · TkA04G503690 · TK1151

Nucleus0.314

Rank 2 · TkA04G503690 · TK1151

Cell membrane0.168

Rank 3 · TkA04G503690 · TK1151

Endoplasmic reticulum0.103

Rank 4 · TkA04G503690 · TK1151

Plastid0.088

Rank 5 · TkA04G503690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30882CCDC146_CC_N7-53 aa

PF30854Par-4_C8-19 aa

PF07851TMEM120A-B11-88 aa

PF24423OVT115-44 aa

PF06818Fez126-127 aa

PF27241CLIP130-89 aa

PF07889DUF166431-79 aa

PF28496NEAP33-51 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G503690	`PF30882`	CCDC146_CC_N	7	53	2.2	8.2
TkA04G503690	`PF30854`	Par-4_C	8	19	0.0061	17.4
TkA04G503690	`PF07851`	TMEM120A-B	11	88	0.69	9.8
TkA04G503690	`PF24423`	OVT1	15	44	7.9	7.7
TkA04G503690	`PF06818`	Fez1	26	127	9.5	7.4
TkA04G503690	`PF27241`	CLIP1	30	89	0.28	11.9
TkA04G503690	`PF07889`	DUF1664	31	79	2.4	8.9
TkA04G503690	`PF28496`	NEAP	33	51	4.8e-40	136.5
TkA04G503690	`PF14257`	DUF4349	37	113	4.3	7.4
TkA04G503690	`PF09762`	CCDC93_CC	41	231	0.51	10.0
TkA04G503690	`PF30882`	CCDC146_CC_N	48	200	2.2	8.2
TkA04G503690	`PF30854`	Par-4_C	56	81	0.0061	17.4
TkA04G503690	`PF27241`	CLIP1	56	177	0.28	11.9
TkA04G503690	`PF28496`	NEAP	63	113	4.8e-40	136.5
TkA04G503690	`PF24423`	OVT1	64	134	7.9	7.7
TkA04G503690	`PF05335`	DUF745	67	169	3.9	7.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K1B4`	Arabidopsis thaliana	sp\|F4K1B4\|NEAP2_ARATH Nuclear envelope-associated protein 2	59.600%	Swiss-Prot	High
`Q4PT37`	Arabidopsis thaliana	sp\|Q4PT37\|NEAP3_ARATH Nuclear envelope-associated protein 3	43.200%	Swiss-Prot	Medium
`Q9M9L3`	Arabidopsis thaliana	sp\|Q9M9L3\|NEAP1_ARATH Nuclear envelope-associated protein 1	49.700%	Swiss-Prot	Medium
`F4I0Z6`	Arabidopsis thaliana	sp\|F4I0Z6\|NEAP4_ARATH Putative nuclear envelope-associated protein 4	58.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card