TkA04G502680 | RubberDandelionOmics

Gene overview

TkA04G502680

Reference: TK1151 Chr: Chr04 Coordinates: 126942090-126945725 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2752 bp · TkA04G502680|TK1151|cDNA

GATGGTTCGCCTCTCTCCTAATCTTCTCGCACACGACCTTCTGTCATCCACTTAACCTTCAAACTTCAGACGTTGTAAAGAAAAAAACAAAAAACAAAAAAAAGGTCCGTCTGCTATCGTGCGCCAACTAAAGGCTCCGGCGACTATACGAGCGGATCTGGTGGAAGTAACTGTGTTGCGACGATGTCAGGAGGAGCAGCCGAACAGCAGTACGCCAAGGCGAAGATATCGGTCTGGTGGGATATAGAGAACTGTCAGGT...

CDS

Download CDS FASTA

2040 bp · TkA04G502680|TK1151|CDS

ATGTCAGGAGGAGCAGCCGAACAGCAGTACGCCAAGGCGAAGATATCGGTCTGGTGGGATATAGAGAACTGTCAGGTACCTAAAGGTTGTGAACCGCATTCGATCGCTCAGAATATAAGTTCTGCTTTGGTTAATATGAACTACTGTGGGCCAGTATCGATATCCGCCTACGGCGACACTAATCGGCTCCCTGCCTCCGTTCAGCAAGGTCTCAACAGTACCGGCATCTCCTTGAATCACGTGCCCGCTGGTGTTAAAGA...

Protein

Download Protein FASTA

679 aa · TkA04G502680|TK1151|PROTEIN

MSGGAAEQQYAKAKISVWWDIENCQVPKGCEPHSIAQNISSALVNMNYCGPVSISAYGDTNRLPASVQQGLNSTGISLNHVPAGVKDASDKKILVDMLFWAVDNPAPCNYLLISGDRDFSNALHQLRMRKYNILLAQPNKASISLIAAAKSVWLWTSLLAGGPPIPNGESPTPDNPPPAPNPVHIPVSESTQMHQQPLDNNMYSNPHPHVGLHKFASMGINKQKGKPLRKNQSQPAAISRTISPPIGVLENQINPNSNSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G502680`
TK1151 ID	TkA04G502680
OH-1004 ID	LXL04_039081
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.200
Protein coverage (%)	TK1151 94.993 / OH-1004 85.695 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G502680`
Location	Chr04:126942090-126945725 (-)
Description	Similar to MARF1: Meiosis regulator and mRNA stability factor 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_039081` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006302 double-strand break repair Biological Process GO:0007143 female meiotic nuclear division Biological Process GO:0010468 regulation of gene expression Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0005737 cytoplasm Cellular Component GO:0005777 peroxisome Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0016020 membrane Cellular Component GO:0003723 RNA binding Molecular Function GO:0004540 RNA nuclease activity Molecular Function GO:1905762 CCR4-NOT complex binding Molecular Function
KEGG gene cross-reference	hsa:9665 mmu:223989 rno:170946 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.472

Rank 1 · TkA04G502680 · TK1151

Cytoplasm0.443

Rank 2 · TkA04G502680 · TK1151

Cell membrane0.143

Rank 3 · TkA04G502680 · TK1151

Endoplasmic reticulum0.076

Rank 4 · TkA04G502680 · TK1151

Golgi apparatus0.042

Rank 5 · TkA04G502680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01936NYN14-150 aa

PF24620DUF7625411-505 aa

PF21524SAMD1_WH427-479 aa

PF14418OHA533-582 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G502680	`PF01936`	NYN	14	150	8.8e-29	101.6
TkA04G502680	`PF24620`	DUF7625	411	505	9.5e-41	138.5
TkA04G502680	`PF21524`	SAMD1_WH	427	479	0.02	15.8
TkA04G502680	`PF14418`	OHA	533	582	6e-11	42.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card