Gene Card
Gene overview
cDNA / CDS / Protein Sequences
4173 bp · TkA04G501270|TK1151|cDNA
CTTAAACCCGTCGTATGTAAAAGTAAAACAAATAGAATCCCCAATAACCATTACACTCATTTTCGACTTTCGTATCCACAACTCGACGTATCAGAGATCACAGCAAACAAATTCGAGTTCCAAATTTCCAATTAGTCTCCAGTCGTCCACGGTCCACCTCTTTCCCTCCCAAAGTTCCGAAACCCTAATCCTTTTGTGAAGACGCCGACGAGTATTTTTGTCCTGAAACCTCAAATAAAGATTGAGGAGGATGGATCCAG...
3576 bp · TkA04G501270|TK1151|CDS
ATGGATCCAGTGGATGCAGAGATAGCGAAGACACAGGAAGAGAGGAAGATTATGGAGGCAGCCCTAGCCCCCAACTCGATCACATTTGACACGGAACTTTATGATGGCAGCAACCGATTTGAGGATTACAACAGGGAGATCCCGGCTAACGATGAGGAGGAAAACGCGGATGCGATGGACAATGAAGTTGCACGGAAGTTGGCTTCTTACACTGCCCCGAGGTCTCTGTTGAACGAGATGCCGAGGGGGGGAGACGATGA...
Protein
Download Protein FASTA1191 aa · TkA04G501270|TK1151|PROTEIN
MDPVDAEIAKTQEERKIMEAALAPNSITFDTELYDGSNRFEDYNREIPANDEEENADAMDNEVARKLASYTAPRSLLNEMPRGGDDDESTGFPKSQKIIDREDEYRRRRLNQVISPERHDAFANGDKTPKPETRSYADIMREAALKREKEETLKVIARRKKEEEENKAAGKEKEREREQQPQAQPSQKRRNRWDQNQEKSDGKKAKTGLDWDMPEDGMSTPGRWDATPTLGRMGDALSRKNRWDETPTPGRTGADSDSTP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G501270 |
|---|---|
| TK1151 ID | TkA04G501270 |
| OH-1004 ID | LXL04_039072 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 98.489 / OH-1004 93.541Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G501270 |
|---|---|
| Location | Chr04:126558732-126563584 (+) |
| Description | Similar to sf3b1: Splicing factor 3B subunit 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000245 spliceosomal complex assembly Biological Process GO:0000375 RNA splicing, via transesterification reactions Biological Process GO:0000387 spliceosomal snRNP assembly Biological Process GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0006338 chromatin remodeling Biological Process GO:0008380 RNA splicing Biological Process GO:0009952 anterior/posterior pattern specification Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0045943 positive regulation of transcription by RNA polymerase I Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0045945 positive regulation of transcription by RNA polymerase III Biological Process |
| KEGG gene cross-reference | hsa:23451 spo:2541619 xla:399336 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08920SF3b1187-229 aaPF08920SF3b1238-287 aaPF08920SF3b1284-414 aaPF12717Cnd1453-471 aaPF23227HEAT_MROH2B_C464-551 aaPF13513HEAT_EZ486-510 aaPF22956PIK3R4-like_middle497-582 aaPF25757TPR_DNAAF5512-567 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G501270 | PF08920 | SF3b1 | 187 | 229 | 3.2e-50 | 170.7 |
| TkA04G501270 | PF08920 | SF3b1 | 238 | 287 | 3.2e-50 | 170.7 |
| TkA04G501270 | PF08920 | SF3b1 | 284 | 414 | 3.2e-50 | 170.7 |
| TkA04G501270 | PF12717 | Cnd1 | 453 | 471 | 8.7e-08 | 33.1 |
| TkA04G501270 | PF23227 | HEAT_MROH2B_C | 464 | 551 | 6.5e-14 | 52.6 |
| TkA04G501270 | PF13513 | HEAT_EZ | 486 | 510 | 1.1e-13 | 52.0 |
| TkA04G501270 | PF22956 | PIK3R4-like_middle | 497 | 582 | 0.00011 | 21.8 |
| TkA04G501270 | PF25757 | TPR_DNAAF5 | 512 | 567 | 3.1e-10 | 40.4 |
| TkA04G501270 | PF13513 | HEAT_EZ | 517 | 550 | 1.1e-13 | 52.0 |
| TkA04G501270 | PF12755 | Vac14_Fab1_bd | 527 | 570 | 0.00047 | 21.4 |
| TkA04G501270 | PF24714 | TOR1L1_N | 528 | 567 | 3.1e-17 | 63.6 |
| TkA04G501270 | PF21041 | XMAP215_CLASP_TOG | 533 | 572 | 5.3e-06 | 27.1 |
| TkA04G501270 | PF13646 | HEAT_2 | 548 | 627 | 4.9e-08 | 33.9 |
| TkA04G501270 | PF12717 | Cnd1 | 574 | 594 | 8.7e-08 | 33.1 |
| TkA04G501270 | PF01602 | Adaptin_N | 575 | 669 | 0.00037 | 19.9 |
| TkA04G501270 | PF02985 | HEAT | 586 | 601 | 5e-12 | 45.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.