TkA04G472720 | RubberDandelionOmics

Gene overview

TkA04G472720

Reference: TK1151 Chr: Chr04 Coordinates: 119392204-119394231 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1367 bp · TkA04G472720|TK1151|cDNA

CACGGTTTCTTCTCCTCCATTCCTACTCCCGAATTCTTCTCTCACGTCGTAATCCTCCCCCAAACTAACCAACTGCATCTCCATCTCCACGTTCTATTTATATGTTCATAACCTAATTGCTTTTCGAATTTGAAATCAATGCAGTTTTGCATTTGGAATATCCTTCACCAGGTAAATCCAAGTGATTTTTCCAATACTTTCTGTTCAAGTTCCTAAAATTCAGATGAGAGCAGCAGTGTGCTTTCCACACTTTCAACTTC...

CDS

Download CDS FASTA

987 bp · TkA04G472720|TK1151|CDS

ATGAGAGCAGCAGTGTGCTTTCCACACTTTCAACTTCCCAAATGCCAGTTTCACACCTTGTCTGGTTCTTGGAGGGAAAAGATCCATAACATTAGCACAAAAAGATCCACTATTTATAATCTTCAAGGCGGGAATAGTAACACCAACAGTAGAAGATGGACCCGCAAATCATTATCTACAAACACAGAAGGAATCGGGAAAAACATCTTAAGCAGACAAAACAACAACATTGGCCAACAAATAACCGATGTAACAACTTT...

Protein

Download Protein FASTA

328 aa · TkA04G472720|TK1151|PROTEIN

MRAAVCFPHFQLPKCQFHTLSGSWREKIHNISTKRSTIYNLQGGNSNTNSRRWTRKSLSTNTEGIGKNILSRQNNNIGQQITDVTTFTHTNLNTSRVEINEFKSIHLEEKISENKDESKLVTVIVFDIETTGFSRENERIIEIALQDLSGGVESTFESLVNPDKFVPNEHIHGISNYMVKQPGVPRMKDLIPILIDYVKSRQKPGGKLLLIAHNGKSFDVPFLINEFSRYSCEIPSDWEFADSMSLAREIMKVQGSKLSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G472720`
TK1151 ID	TkA04G472720
OH-1004 ID	LXL04_038869
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G472720

Location Chr04:119392204-119394231 (-)

Description Similar to DPD1: Exonuclease DPD1, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26940`	Exonuclease required for organelle DNA degradation during pollen development.	A conserved, Mg²+-dependent exonuclease degrades organelle DNA during Arabidopsis pollen development.2011 · DOI: 10.1105/tpc.111.084012 Tissue-specific organelle DNA degradation mediated by DPD1 exonuclease.2011 · DOI: 10.4161/psb.6.9.16595

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038869 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006308 DNA catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0004527 exonuclease activity Molecular Function

GO:0008296 3'-5'-DNA exonuclease activity Molecular Function

GO:0008408 3'-5' exonuclease activity Molecular Function

KEGG gene cross-reference

ath:AT5G26940

cpe:CPE1691

ctc:CTC_01271

oih:OB1593

tte:TTE1398

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.765

Rank 1 · TkA04G472720 · TK1151

Cytoplasm0.150

Rank 2 · TkA04G472720 · TK1151

Nucleus0.116

Rank 3 · TkA04G472720 · TK1151

Plastid0.063

Rank 4 · TkA04G472720 · TK1151

Peroxisome0.035

Rank 5 · TkA04G472720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03104DNA_pol_B_exo193-229 aa

PF00929RNase_T124-291 aa

PF13482RNase_H_2125-275 aa

PF16473Rv2179c-like125-292 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G472720	`PF03104`	DNA_pol_B_exo1	93	229	0.00039	20.6
TkA04G472720	`PF00929`	RNase_T	124	291	2.8e-21	77.4
TkA04G472720	`PF13482`	RNase_H_2	125	275	1e-07	32.8
TkA04G472720	`PF16473`	Rv2179c-like	125	292	0.00045	20.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q682U6`	Arabidopsis thaliana	sp\|Q682U6\|DPD1_ARATH Exonuclease DPD1, chloroplastic/mitochondrial	44.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card