TkA04G472270 | RubberDandelionOmics

Gene overview

TkA04G472270

Reference: TK1151 Chr: Chr04 Coordinates: 119287081-119290227 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2004 bp · TkA04G472270|TK1151|cDNA

AATAAATAAACTTTCGATTTTTGCTCTAACACACAGAATTTTTACCGGTTACTCGTTAGCGGTAGTGTACTGTCACTCTCGCGCGGGCGAATTGTGTGAGTATCAACTCTGCCAATCACGGTTAGCATATCTGTACTTTCTGTACTTCATTACGACTAAACCATGGCCACCAATCCCCTGATTTCACCTTTTGCCACAGTTTCATCGGCCGACAACCACCTATTCGCCGCCATCGACCTCGGAACCAACTCCTTCAAACT...

CDS

Download CDS FASTA

1695 bp · TkA04G472270|TK1151|CDS

ATGGCCACCAATCCCCTGATTTCACCTTTTGCCACAGTTTCATCGGCCGACAACCACCTATTCGCCGCCATCGACCTCGGAACCAACTCCTTCAAACTCCGCATTGTCCGAGCTGACCCCACAACCGGCCGTTTTCTCACCCTCCAACGACTCAAGGAACCCGTTGTTCTCGTCTCCGGCGGCAACAACAACAACACCACCATATCCTCCTCAGCTCAAGCCCGCGCCATCGAATCTCTTCGAAACTTCCAAAACATCAT...

Protein

Download Protein FASTA

564 aa · TkA04G472270|TK1151|PROTEIN

MATNPLISPFATVSSADNHLFAAIDLGTNSFKLRIVRADPTTGRFLTLQRLKEPVVLVSGGNNNNTTISSSAQARAIESLRNFQNIINSLNVPPSHRRLVATSAIRESSNQSEFLQLIHQTLGLQIDVVSGYEEARLTYLGVLQFHPIYNHTVLTIDIGGGSTEFVVGFQGNIKFGISLKLGHVTLTQRFVRNNATDAMREHIRATVKESGLIENVLQQKIDIAVGSSGSIRMIEKAIFLGYSNDLVNEIGLLEGFRRDW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G472270`
TK1151 ID	TkA04G472270
OH-1004 ID	LXL04_038864
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G472270`
Location	Chr04:119287081-119290227 (-)
Description	Similar to ppx: Exopolyphosphatase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_038864` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006798 polyphosphate catabolic process Biological Process GO:0006995 cellular response to nitrogen starvation Biological Process GO:0009247 glycolipid biosynthetic process Biological Process GO:0009372 quorum sensing Biological Process GO:0016036 cellular response to phosphate starvation Biological Process GO:0042594 response to starvation Biological Process GO:0044010 single-species biofilm formation Biological Process GO:0005886 plasma membrane Cellular Component GO:0004309 exopolyphosphatase activity Molecular Function GO:0008976 polyphosphate kinase activity Molecular Function
KEGG gene cross-reference	pae:PA5241 stm:STM2502 stt:t0355 sty:STY2743 vch:VC_0722 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.618

Rank 1 · TkA04G472270 · TK1151

Nucleus0.333

Rank 2 · TkA04G472270 · TK1151

Peroxisome0.066

Rank 3 · TkA04G472270 · TK1151

Mitochondrion0.063

Rank 4 · TkA04G472270 · TK1151

Plastid0.060

Rank 5 · TkA04G472270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02541Ppx-GppA42-335 aa

PF14450FtsA156-200 aa

PF21447Ppx-GppA_III349-517 aa

PF01966HD401-464 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G472270	`PF02541`	Ppx-GppA	42	335	3.3e-44	152.2
TkA04G472270	`PF14450`	FtsA	156	200	0.17	12.9
TkA04G472270	`PF21447`	Ppx-GppA_III	349	517	1e-19	71.7
TkA04G472270	`PF01966`	HD	401	464	0.002	19.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card