Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3652 bp · TkA04G465460|TK1151|cDNA
ACTCTAAGATGTAGAACTATATTTTATTTTTCACTTACTATTATCATTGGGCATCTATGCTGTGAGCAATTACGCACGTGACTTACTTTTTAGCAACTGTGAAAAAAACAATCTGTGCACTAAAACATCGCTACCACCGTGTGCTTGTCAGAAATAGAGAGAGACAGATAGATTCCGGCGAAGATCCGGAGAAAGCATGTCTAGCAGCAATGGCGATTCACTGGACTCCAAACGGAACCCTAACATTCCGCTGCCAGAAC...
2400 bp · TkA04G465460|TK1151|CDS
ATGTCTAGCAGCAATGGCGATTCACTGGACTCCAAACGGAACCCTAACATTCCGCTGCCAGAACGGCGTCCTCTCCTTAAGAAATCAAGGACGATCGCTGATTCCACCGCTGCTCACTTCCCCGGTCCACTCTTCCCAGCCGTCCGCCGGCTCGCCTCCGATGAGTCACCACCACCTCTTCCACCATCTTCCTCCTCCACCTGGTCCCCCCGACGATCATTCGACTCATCCGACAGCTCCAGCACTACTGCCAGCGACAC...
Protein
Download Protein FASTA799 aa · TkA04G465460|TK1151|PROTEIN
MSSSNGDSLDSKRNPNIPLPERRPLLKKSRTIADSTAAHFPGPLFPAVRRLASDESPPPLPPSSSSTWSPRRSFDSSDSSSTTASDTFPGQTFGFGDRDYVYPSFLGPNTTRNRVTVVKSSTSKSLRKQPPVSSPSPSPVRSASMPKNLTSTGGSEMESVSASPITPHLPSRGSDTKSEKIVLPVRAQVPVSSSTSSSSLTSSTPARKNARIRSSLIRNLLALLCVVFASYAISLRNEVTKLQEENQDLHRTCRNKDIPH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G465460 |
|---|---|
| TK1151 ID | TkA04G465460 |
| OH-1004 ID | LXL04_038788 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 98.300 |
| Protein coverage (%) | TK1151 98.248 / OH-1004 80.184Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G465460 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:117502891-117509119 (-) | ||||||||||||
| Description | Similar to DMI1: Ion channel DMI1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006813 potassium ion transport Biological Process GO:0034220 monoatomic ion transmembrane transport Biological Process GO:0009507 chloroplast Cellular Component GO:0031965 nuclear membrane Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT5G49960 dosa:Os01g0870100 mtr:11433851 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF22614Slo-like_RCK442-546 aaPF02080TrkA_C456-482 aaPF06241Castor_Poll_mid585-682 aaPF02080TrkA_C650-677 aaPF02080TrkA_C699-719 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G465460 | PF22614 | Slo-like_RCK | 442 | 546 | 1.9e-07 | 31.5 |
| TkA04G465460 | PF02080 | TrkA_C | 456 | 482 | 0.00068 | 20.2 |
| TkA04G465460 | PF06241 | Castor_Poll_mid | 585 | 682 | 5.5e-42 | 142.7 |
| TkA04G465460 | PF02080 | TrkA_C | 650 | 677 | 0.00068 | 20.2 |
| TkA04G465460 | PF02080 | TrkA_C | 699 | 719 | 0.00068 | 20.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.