TkA04G462610 | RubberDandelionOmics

Gene overview

TkA04G462610

Reference: TK1151 Chr: Chr04 Coordinates: 116774575-116774892 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

318 bp · TkA04G462610|TK1151|cDNA

ATGCATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTTTGTGTTGATAAACTTGAAACTACAAACTACATGTATGGTTTTAGGTATCATGGCTACAGGAGCCATAAATGTTGTGAGGGGATCTACATCATCTGTTGAAGAACTGTTACACATCTACACTCATTCTGAAAGGTTAGCAAACTCTTATCTCCCTTTCACATATCCATTCTGTTTGCTTTCAGTCATTGTTTTATCACCCATTTT...

CDS

Download CDS FASTA

318 bp · TkA04G462610|TK1151|CDS

ATGCATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTTTGTGTTGATAAACTTGAAACTACAAACTACATGTATGGTTTTAGGTATCATGGCTACAGGAGCCATAAATGTTGTGAGGGGATCTACATCATCTGTTGAAGAACTGTTACACATCTACACTCATTCTGAAAGGTTAGCAAACTCTTATCTCCCTTTCACATATCCATTCTGTTTGCTTTCAGTCATTGTTTTATCACCCATTTT...

Protein

Download Protein FASTA

105 aa · TkA04G462610|TK1151|PROTEIN

MHYYYYYYYYYYYYYYYYFVLINLKLQTTCMVLGIMATGAINVVRGSTSSVEELLHIYTHSERLANSYLPFTYPFCLLSVIVLSPIFQESKLTFWEKVDYFQLQN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G462610`
TK1151 ID	TkA04G462610
OH-1004 ID	LXL04_033243
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	90.600
Protein coverage (%)	TK1151 30.476 / OH-1004 4.378 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G462610

Location Chr04:116774575-116774892 (-)

Description Similar to AAE15: Long-chain-fatty-acid--[acyl-carrier-protein] ligase AEE15, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23790`	May be involved in the activation of fatty acids to acyl-carrier-protein.	No verified direct reference in this release
`At4g14070`	Probably involved in the activation of fatty acids to acyl- carrier-protein prior to fatty acid elongation in plastids.	Identification of a plastid acyl-acyl carrier protein synthetase in Arabidopsis and its role in the activation and elongation of exogenous fatty acids.2005 · DOI: 10.1111/j.1365-313x.2005.02553.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033243 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010193 response to ozone Biological Process

GO:0030497 fatty acid elongation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT2G47240

ath:AT3G23790

ath:AT4G14070

ath:AT5G27600

mmi:MMAR_3231

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.354

Rank 1 · TkA04G462610 · TK1151

Nucleus0.332

Rank 2 · TkA04G462610 · TK1151

Endoplasmic reticulum0.181

Rank 3 · TkA04G462610 · TK1151

Mitochondrion0.174

Rank 4 · TkA04G462610 · TK1151

Cell membrane0.116

Rank 5 · TkA04G462610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK39`	Arabidopsis thaliana	sp\|Q9LK39\|AAE16_ARATH Probable acyl-activating enzyme 16, chloroplastic	81.300%	Swiss-Prot	Low
`Q8W471`	Arabidopsis thaliana	sp\|Q8W471\|AAE15_ARATH Long-chain-fatty-acid--[acyl-carrier-protein] ligase AEE15, chloroplastic	81.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card