TkA04G454420 | RubberDandelionOmics

Gene overview

TkA04G454420

Reference: TK1151 Chr: Chr04 Coordinates: 114568568-114571049 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2073 bp · TkA04G454420|TK1151|cDNA

AAAGATGGAAGATCTATAGCATGACGCGGTAAACAGAAATTCGGGAAAATGCTCTCACTGCGACAGTGCCTGAACAAAAAAGAGGTAGAGAGAGACGACGAATTTGGGGAACGATTTGCTCCTGTGAGTCCCCTTCGTTCTTCACTCATCCCCTTACGGCCTTACGCCTTAGCCAATCGATTGGCGCATCAACGAAATCATGTCAAACACCACCACCACAAAAGACGATGAATATGGAGTCCTATTATACTACAACTACA...

CDS

Download CDS FASTA

1644 bp · TkA04G454420|TK1151|CDS

ATGTCAAACACCACCACCACAAAAGACGATGAATATGGAGTCCTATTATACTACAACTACACCAAAATCCCAAATCTCAACGACCTATTCACCTTCTACAACACCAACTGCACCTCCCTCTCTCTCCTCGGCCGCATCCGCCTCTCCCCTCACGGAGTCAACGCCACAATCGGCGGTCAACCCTCATCTCTAAAACAACACATCACTGCCCTCACCTCAACCTACCCTTCCTTCACTTCAACAGATTTCAAATTAGCAAC...

Protein

Download Protein FASTA

547 aa · TkA04G454420|TK1151|PROTEIN

MSNTTTTKDDEYGVLLYYNYTKIPNLNDLFTFYNTNCTSLSLLGRIRLSPHGVNATIGGQPSSLKQHITALTSTYPSFTSTDFKLATSKIHPINNKTAQETGFTSLSIRIVKELVTFTSHHPPEIPISNAGQHLSAREFHSVLESAHPENLVLLDARNLYETRIGKFSPPNVETLDPKIRQYSDLSSWVDNNTEKIRGKKILMYCTGGIRCEVASAYIKSKGTGFENVFQLYGGIQRYMELFPEGGFFKGKNFVFDHRVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G454420`
TK1151 ID	TkA04G454420
OH-1004 ID	LXL04_038673
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 81.157 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G454420

Location Chr04:114568568-114571049 (-)

Description Similar to STR6: Rhodanese-like domain-containing protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09280`	Rhodanese-like domain-containing protein 6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038673 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006400 tRNA modification Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G09280

cjk:jk0240

hsa:158427

mmu:272027

pon:100172136

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.588

Rank 1 · TkA04G454420 · TK1151

Cytoplasm0.536

Rank 2 · TkA04G454420 · TK1151

Mitochondrion0.123

Rank 3 · TkA04G454420 · TK1151

Plastid0.029

Rank 4 · TkA04G454420 · TK1151

Peroxisome0.026

Rank 5 · TkA04G454420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17773UPF0176_N12-113 aa

PF00581Rhodanese170-239 aa

PF12368Rhodanese_C249-313 aa

PF03959FSH1327-538 aa

PF00561Abhydrolase_1422-458 aa

PF02230Abhydrolase_2442-495 aa

PF00561Abhydrolase_1473-529 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G454420	`PF17773`	UPF0176_N	12	113	8.8e-15	55.6
TkA04G454420	`PF00581`	Rhodanese	170	239	0.0015	19.7
TkA04G454420	`PF12368`	Rhodanese_C	249	313	9.4e-14	52.2
TkA04G454420	`PF03959`	FSH1	327	538	1.1e-39	137.0
TkA04G454420	`PF00561`	Abhydrolase_1	422	458	0.2	12.0
TkA04G454420	`PF02230`	Abhydrolase_2	442	495	0.011	16.2
TkA04G454420	`PF00561`	Abhydrolase_1	473	529	0.2	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AC1`	Arabidopsis thaliana	sp\|Q94AC1\|STR6_ARATH Rhodanese-like domain-containing protein 6	58.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card