TkA04G439490 | RubberDandelionOmics

Gene overview

TkA04G439490

Reference: TK1151 Chr: Chr04 Coordinates: 110857434-110859945 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2016 bp · TkA04G439490|TK1151|cDNA

AAAGAAAATAAAAACAACAATACACGGATCAAAAATCACAAAAATCTTAACCGCCTTTTGAAACCCTAAAACCATACCCTCTCCTACAGCACTGGTAGTCTTCGACATTCAACGCCTTCGAGCGCTCTCCTCCCGCAATACCTCCGTCATCCACGTCGCAGCCTTCGGCGACCGCTCACGGCGCCATCACCAAATCATCTCTAACGCAGTGCTTAAGAAATGACACAAGAAACAGGAATGTTCACGGTCCAAGAAACCAT...

CDS

Download CDS FASTA

1539 bp · TkA04G439490|TK1151|CDS

ATGACACAAGAAACAGGAATGTTCACGGTCCAAGAAACCATAGGCAGCGTCCTCTGCTGCAAATGCGGCATCTCAATGACCCCAAATGCCGCCAACATGTGTGTCAAATGCCTCCGTTCAGAAATCGACATCACCGAAAACCTCCAAAAACACATCACCATAATCCACTGCCCAGAATGCGACACCTACCTCCAACCCCCCCGCACATGGATCAAAGCCCAACTCGAATCAAAAGAACTCCTCACCTTCTGCGTCAAACG...

Protein

Download Protein FASTA

512 aa · TkA04G439490|TK1151|PROTEIN

MTQETGMFTVQETIGSVLCCKCGISMTPNAANMCVKCLRSEIDITENLQKHITIIHCPECDTYLQPPRTWIKAQLESKELLTFCVKRIKNLNKLRLIHAEFIWTEPHSKRLKVKLKVQKEVLNGAVLEQSHTSEYTVQDQMCDSCSRAQANPDQWVASVQLRQQVAHRRTFFYLEQLILTHDAAIKATRIKQMDRGIDFFFSTRSHAAKFLEFLQKVAPIKSRHDKQLVSHDTKSNHYNYRYTFSVEISPICREDLVLLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G439490`
TK1151 ID	TkA04G439490
OH-1004 ID	LXL04_038529
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G439490`
Location	Chr04:110857434-110859945 (+)
Description	Similar to Nmd3: 60S ribosomal export protein NMD3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_038529` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000055 ribosomal large subunit export from nucleus Biological Process GO:0015031 protein transport Biological Process GO:1902680 positive regulation of RNA biosynthetic process Biological Process GO:1904751 positive regulation of protein localization to nucleolus Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0003723 RNA binding Molecular Function GO:0030674 protein-macromolecule adaptor activity Molecular Function
KEGG gene cross-reference	ddi:DDB_G0271306 hsa:51068 mmu:97112 pon:100174372 xtr:394998 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.839

Rank 1 · TkA04G439490 · TK1151

Cytoplasm0.246

Rank 2 · TkA04G439490 · TK1151

Mitochondrion0.016

Rank 3 · TkA04G439490 · TK1151

Cell membrane0.016

Rank 4 · TkA04G439490 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA04G439490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17026zf-RRPl_C412-27 aa

PF29994NMD3_N19-149 aa

PF17026zf-RRPl_C445-65 aa

PF17026zf-RRPl_C4123-165 aa

PF04981NMD3154-248 aa

PF21192OB_NMD3185-212 aa

PF29994NMD3_N214-248 aa

PF21193NMD_SH3251-295 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G439490	`PF17026`	zf-RRPl_C4	12	27	5.0	8.0
TkA04G439490	`PF29994`	NMD3_N	19	149	4.9e-34	118.4
TkA04G439490	`PF17026`	zf-RRPl_C4	45	65	5.0	8.0
TkA04G439490	`PF17026`	zf-RRPl_C4	123	165	5.0	8.0
TkA04G439490	`PF04981`	NMD3	154	248	1.7e-31	109.4
TkA04G439490	`PF21192`	OB_NMD3	185	212	5.2e-31	107.5
TkA04G439490	`PF29994`	NMD3_N	214	248	4.9e-34	118.4
TkA04G439490	`PF21193`	NMD_SH3	251	295	1.7e-18	67.2
TkA04G439490	`PF21192`	OB_NMD3	315	405	5.2e-31	107.5
TkA04G439490	`PF29994`	NMD3_N	421	442	4.9e-34	118.4
TkA04G439490	`PF21192`	OB_NMD3	473	485	5.2e-31	107.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card