TkA04G428860 | RubberDandelionOmics

Gene overview

TkA04G428860

Reference: TK1151 Chr: Chr04 Coordinates: 108236081-108241682 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1518 bp · TkA04G428860|TK1151|cDNA

ATACGAAGCGTTGTACCATACGCATCCATACTTGTACCTTTGACATGCAAAATCAAAGGTAACAAATCAGATTTTGTGTCCTGAATCTTACTGTTCCACTATCCCAAATCCCCGGTCCTCTCTAGCCACTCCCCCCTCAACCACCTTCCACCACCGCCATATCCTCCGGCTGACCATCTGAATGTCTACCACTCTACTTCCATTTAAAACCCACCACCTCTCTCACTCCCTTGATCCCCAATTCCGGAAACGCTCCTTCA...

CDS

Download CDS FASTA

1725 bp · TkA04G428860|TK1151|CDS

ATGTCTACCACTCTACTTCCATTTAAAACCCACCACCTCTCTCACTCCCTTGATCCCCAATTCCGGAAACGCTCCTTCATCTCGTTACCTCCGCCACCGCCTCTGTTCACTCCCAGACGTCCGAAGCTTCTTCATAGAAATGGGGTTTTAGCACGTGCAGAAGATAAGGCACGTGAAGCAGGAGGAAACTCATCGTCGACTCAACAACCGCCGAAACCCGATTCGGATAAGCAATTTCAGGATTTAGCATCATCGGGACC...

Protein

Download Protein FASTA

574 aa · TkA04G428860|TK1151|PROTEIN

MSTTLLPFKTHHLSHSLDPQFRKRSFISLPPPPPLFTPRRPKLLHRNGVLARAEDKAREAGGNSSSTQQPPKPDSDKQFQDLASSGPCDPLCSVDETSSQEYEATYQPKTDLLKALAVFGAAATGAVAINHSWVAENQDLAMALLFGLGYAGIIFEESLAFNKSGVGLVMAVSLWVIRSIGAPSTDIAVAELTHASAEVSEIVFFLLGAMTIVEIVDAHQGFKLVTDNITTRKPRSLLWVVGFVTFFLSSILDNLTSTIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G428860`
TK1151 ID	TkA04G428860
OH-1004 ID	LXL04_038437
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G428860

Location Chr04:108236081-108241682 (+)

Description Similar to NHD1: Sodium/proton antiporter 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19490`	May act as a Na⁺/H⁺ antiporter that exports Na⁺ in exchange for external protons.	Decreased capacity for sodium export out of Arabidopsis chloroplasts impairs salt tolerance, photosynthesis and plant performance.2014 · DOI: 10.1111/tpj.12501
`At1g49810`	Na(+)/H(+) antiporter that extrudes sodium in exchange for external protons.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038437 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006814 sodium ion transport Biological Process

GO:0006848 pyruvate transport Biological Process

GO:0009651 response to salt stress Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

GO:0050833 pyruvate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G49810

ath:AT3G19490

vco:VC0395_0225

vcr:VC395_A1039

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.970

Rank 1 · TkA04G428860 · TK1151

Mitochondrion0.028

Rank 2 · TkA04G428860 · TK1151

Cell membrane0.019

Rank 3 · TkA04G428860 · TK1151

Cytoplasm0.019

Rank 4 · TkA04G428860 · TK1151

Golgi apparatus0.019

Rank 5 · TkA04G428860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03600CitMHS151-488 aa

PF03600CitMHS500-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G428860	`PF03600`	CitMHS	151	488	8.5e-24	85.0
TkA04G428860	`PF03600`	CitMHS	500	522	8.5e-24	85.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT68`	Arabidopsis thaliana	sp\|Q9LT68\|NHD1_ARATH Sodium/proton antiporter 1	82.100%	Swiss-Prot	High
`Q9C6D3`	Arabidopsis thaliana	sp\|Q9C6D3\|NHD2_ARATH Sodium/proton antiporter 2	74.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card