TkA04G423600 | RubberDandelionOmics

Gene overview

TkA04G423600

Reference: TK1151 Chr: Chr04 Coordinates: 106781581-106790894 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6115 bp · TkA04G423600|TK1151|cDNA

CAAAATTCAGCAACAAATCTCAACCGTCGATCATAAACCAGATCTCGGCAATTTCAATCAAAAAGCTTTCAAAAAACAGTCATTCGATAAAAAAACGACTGACAGAGAAACGGAGAGAGAGAGATAGAGAGAAAGATTTTGAATTCAATTAACTACACCCTTAAAACCCATGAAAGCAATCATACAACTACAGTTCATTTAGAGGTCTTGTAGTAACTATGAAGTGATGTTTTTCAGCTCGAGATCTTGAGTGTTCTACT...

CDS

Download CDS FASTA

5397 bp · TkA04G423600|TK1151|CDS

ATGATGCGAAATTCCAAGCTCTCGCGACGAAATTCTGGTAAGAATCTTAATTTCGAAGAAATTGAAAATGTGCCGGTAAATGTTAACCTTCGTGAGTCATCGGTTCGTCGGATGAGCTTCGATTCTAGCTCCAGGCCTCCATTGAACTCAATTAAAGATCCCCTTCAAAACCCTAGCAAACCAGGTCAAGAGTCGGGATTCAAGAGCTCGAAAACTTACAGAACACCCACAAAAGCAAAAAGCAGGTTTCAAGAACCCTC...

Protein

Download Protein FASTA

1798 aa · TkA04G423600|TK1151|PROTEIN

MMRNSKLSRRNSGKNLNFEEIENVPVNVNLRESSVRRMSFDSSSRPPLNSIKDPLQNPSKPGQESGFKSSKTYRTPTKAKSRFQEPSMPMRTPEKQGVLARDRFGWGHDSAVNTPRSCRTPGRAFFGPSELNSTHTTPTKSVTKPPNPGLTYGGNSRPPVRTGNFAALSRGIPVTSTNHTTVNTIEVPHFDLREDPSFWMDHNVQVLIRIRPLNAMEITSQGYNRSLKQESAESLTWIGNGHPETRFTFDHVACETIDQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G423600`
TK1151 ID	TkA04G423600
OH-1004 ID	LXL04_038357
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.900
Protein coverage (%)	TK1151 98.999 / OH-1004 91.572 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G423600

Location Chr04:106781581-106790894 (-)

Description Similar to KIN12D: Kinesin-like protein KIN-12D

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19050`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034
`At3g17360`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034 Tangled localization at the cortical division site of plant cells occurs by several mechanisms.2011 · DOI: 10.1242/jcs.073676

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0590500`	Kinesin-like protein KIN-12F.	No verified direct reference in this release
`Os07g0638000`	Kinesin-like protein KIN-12E.	No verified direct reference in this release
`UniProt: Q75LL2`	Kinesin-like protein KIN-12G.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038357 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007018 microtubule-based movement Biological Process

GO:0080175 phragmoplast microtubule organization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0032153 cell division site Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT3G19050

dosa:Os12g0590500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.670

Rank 1 · TkA04G423600 · TK1151

Nucleus0.287

Rank 2 · TkA04G423600 · TK1151

Cell membrane0.071

Rank 3 · TkA04G423600 · TK1151

Golgi apparatus0.054

Rank 4 · TkA04G423600 · TK1151

Mitochondrion0.047

Rank 5 · TkA04G423600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796Microtub_bd203-357 aa

PF00225Kinesin209-542 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G423600	`PF16796`	Microtub_bd	203	357	3e-21	76.7
TkA04G423600	`PF00225`	Kinesin	209	542	1.7e-113	379.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q27IK6`	Arabidopsis thaliana	sp\|Q27IK6\|KN12D_ARATH Kinesin-like protein KIN-12D	42.100%	Swiss-Prot	Medium
`Q27IK7`	Arabidopsis thaliana	sp\|Q27IK7\|KN12C_ARATH Kinesin-like protein KIN-12C	55.100%	Swiss-Prot	Low
`B9GE13`	Oryza sativa subsp. japonica	sp\|B9GE13\|KN12F_ORYSJ Kinesin-like protein KIN-12F	40.900%	Swiss-Prot	Medium
`B9FUF9`	Oryza sativa subsp. japonica	sp\|B9FUF9\|KN12E_ORYSJ Kinesin-like protein KIN-12E	61.200%	Swiss-Prot	Low
`Q75LL2`	Oryza sativa subsp. japonica	sp\|Q75LL2\|KN12G_ORYSJ Kinesin-like protein KIN-12G	58.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card