TkA04G419480 | RubberDandelionOmics

Gene overview

TkA04G419480

Reference: TK1151 Chr: Chr04 Coordinates: 105673894-105686592 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1348 bp · TkA04G419480|TK1151|cDNA

TCTCCCTCCTCTATTCTTCCCAGCGTAACCCGTAATACGCGCACATTGATTTTCAAGATTTTGCAGCTGAGAGAATAGAGGAGCTTGACGAGTGTCGTTCCGCATTACGAGTATAACAACATACTGAAAACCGGTAGCGTTTGGAGGACTCATCGGACACAGTCGAGCCATGTCGAATCGAATCCCCAAATCAAAAAAGAGAAAAACGTCCCCATATTTACACCAAACACAATCCGAAAAAATCATACACACATACACAC...

CDS

Download CDS FASTA

948 bp · TkA04G419480|TK1151|CDS

ATGTCGAATCGAATCCCCAAATCAAAAAAGAGAAAAACGTCCCCATATTTACACCAAACACAATCCGAAAAAATCATACACACATACACACTCTTGGAAGAAAGTCAACCATCCGGTCAACTCATTACAGACATGGAAGATTCAATTGCGGCTATAGAATCCATATTAAGGTACAACTTCAACAACAAAAGATTGTTAGAAGCAGCCTTAACACATCCTTCTTACACCGAGAGTACCTCATATCAACACCTCGAATTTGT...

Protein

Download Protein FASTA

315 aa · TkA04G419480|TK1151|PROTEIN

MSNRIPKSKKRKTSPYLHQTQSEKIIHTYTLLEESQPSGQLITDMEDSIAAIESILRYNFNNKRLLEAALTHPSYTESTSYQHLEFVGDFVLGFAISNFVDLAYPSLDPGQLSLLRAANISTEKLARVAVRNGLYKYVRHRDTVLSDKVGKFVNVVEEEEYMVVHGGQMKAPKVLADIVESIIGAVFIDCGRDIQRLWLIIRHLLEPLVMLNVLEKQPQPITMLFEACQKVGKTVDIRHWRKGERNIASVFIDGRFFATG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G419480`
TK1151 ID	TkA04G419480
OH-1004 ID	LXL04_038351
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.365 / OH-1004 91.520 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G419480

Location Chr04:105673894-105686592 (-)

Description Similar to RTL2: Ribonuclease 3-like protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20420`	Ribonuclease that cleaves double-stranded RNA (dsRNA).	Characterization of a ribonuclease III-like protein required for cleavage of the pre-rRNA in the 3'ETS in Arabidopsis.2008 · DOI: 10.1093/nar/gkm1130 An Arabidopsis RNase III-like protein, AtRTL2, cleaves double-stranded RNA in vitro.2011 · DOI: 10.1007/s10265-010-0382-x
`At5g45150`	Ribonuclease that cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0271300`	Cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release
`Os06g0358800`	Cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release
`Os01g0551100`	Cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038351 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0030422 siRNA processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0004525 ribonuclease III activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G20420

ath:AT5G45150

dosa:Os05g0271300

dosa:Os06g0358800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.747

Rank 1 · TkA04G419480 · TK1151

Cytoplasm0.298

Rank 2 · TkA04G419480 · TK1151

Cell membrane0.039

Rank 3 · TkA04G419480 · TK1151

Endoplasmic reticulum0.027

Rank 4 · TkA04G419480 · TK1151

Plastid0.022

Rank 5 · TkA04G419480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17938TetR_C_299-91 aa

PF14622Ribonucleas_3_362-193 aa

PF00636Ribonuclease_382-191 aa

PF17938TetR_C_29152-186 aa

PF00035dsrm220-280 aa

PF24995DSRM_2242-281 aa

PF14622Ribonucleas_3_3266-302 aa

PF00035dsrm295-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G419480	`PF17938`	TetR_C_29	9	91	0.13	13.1
TkA04G419480	`PF14622`	Ribonucleas_3_3	62	193	3.2e-18	66.8
TkA04G419480	`PF00636`	Ribonuclease_3	82	191	5.8e-19	69.5
TkA04G419480	`PF17938`	TetR_C_29	152	186	0.13	13.1
TkA04G419480	`PF00035`	dsrm	220	280	1.3e-09	39.2
TkA04G419480	`PF24995`	DSRM_2	242	281	0.18	13.1
TkA04G419480	`PF14622`	Ribonucleas_3_3	266	302	3.2e-18	66.8
TkA04G419480	`PF00035`	dsrm	295	306	1.3e-09	39.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTQ0`	Arabidopsis thaliana	sp\|Q9LTQ0\|RTL2_ARATH Ribonuclease 3-like protein 2	47.300%	Swiss-Prot	Medium
`Q9FKF0`	Arabidopsis thaliana	sp\|Q9FKF0\|RTL3_ARATH Ribonuclease 3-like protein 3	38.900%	Swiss-Prot	Medium
`Q6ATG6`	Oryza sativa subsp. japonica	sp\|Q6ATG6\|RTL2_ORYSJ Ribonuclease 3-like protein 2	44.700%	Swiss-Prot	Medium
`Q69KJ0`	Oryza sativa subsp. japonica	sp\|Q69KJ0\|RTL3_ORYSJ Ribonuclease 3-like protein 3	38.500%	Swiss-Prot	Medium
`Q5JK90`	Oryza sativa subsp. japonica	sp\|Q5JK90\|RTL1_ORYSJ Ribonuclease 3-like protein 1	33.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card