TkA04G418850 | RubberDandelionOmics

Gene overview

TkA04G418850

Reference: TK1151 Chr: Chr04 Coordinates: 105542902-105548874 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3639 bp · TkA04G418850|TK1151|cDNA

ATGGCATTAGCGGAAAATCCCAATTCGTCAAAGGAGAAGAGATTTTCCTCATCAGTCGTATGGGTCGCCAGTCGGGAAACCTCACTCACAGACACCTCCAGCGTATTGCTTCTCAGAGATATCGGAACTCTCACACTCCTTAATCAGACGAATTGTCTGAAAGTTGCCATCATTGAAGGTGATGTGGTTGGAGGAACATGTGTTAACCGTGGTTGTGTTCCTTCTAAAGCTCTTCTTGCAGTCAGGGGTCGTATGAGGGA...

CDS

Download CDS FASTA

3639 bp · TkA04G418850|TK1151|CDS

ATGGCATTAGCGGAAAATCCCAATTCGTCAAAGGAGAAGAGATTTTCCTCATCAGTCGTATGGGTCGCCAGTCGGGAAACCTCACTCACAGACACCTCCAGCGTATTGCTTCTCAGAGATATCGGAACTCTCACACTCCTTAATCAGACGAATTGTCTGAAAGTTGCCATCATTGAAGGTGATGTGGTTGGAGGAACATGTGTTAACCGTGGTTGTGTTCCTTCTAAAGCTCTTCTTGCAGTCAGGGGTCGTATGAGGGA...

Protein

Download Protein FASTA

1212 aa · TkA04G418850|TK1151|PROTEIN

MALAENPNSSKEKRFSSSVVWVASRETSLTDTSSVLLLRDIGTLTLLNQTNCLKVAIIEGDVVGGTCVNRGCVPSKALLAVRGRMRELQNEHNMKYFSLQINSIHIANSVGAPNKAPILVTDEYNHWVTRFKGYIEGKDEEIWRSIIKGPHKPTPQRLATEAELALGGEATPTLTQDDLLKMKADRQAVSELNCAIPPNVFNLVEDCVSAHETWNTLHQLFAGTEAAKDQKMTSAINAFSSFKALPSESLQETFKRFKVC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G418850`
TK1151 ID	TkA04G418850
OH-1004 ID	LXL04_029455
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	66.500
Protein coverage (%)	TK1151 91.914 / OH-1004 35.588 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G418850

Location Chr04:105542902-105548874 (+)

Description Similar to RE1: Retrovirus-related Pol polyprotein from transposon RE1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release
`At3g16950`	Lipoamide dehydrogenase is a component of the plastidial pyruvate dehydrogenase complex (PDC).	No verified direct reference in this release
`At4g16155`	Lipoamide dehydrogenase is a component of the plastidial pyruvate dehydrogenase complex (PDC).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029455 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.506

Rank 1 · TkA04G418850 · TK1151

Nucleus0.477

Rank 2 · TkA04G418850 · TK1151

Mitochondrion0.060

Rank 3 · TkA04G418850 · TK1151

Cell membrane0.041

Rank 4 · TkA04G418850 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA04G418850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453B_lectin19-51 aa

PF07992Pyr_redox_251-92 aa

PF14223Retrotran_gag_2182-296 aa

PF22936Pol_BBD231-248 aa

PF00727IL4410-459 aa

PF00098zf-CCHC418-433 aa

PF14223Retrotran_gag_2480-508 aa

PF00727IL4552-607 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G418850	`PF01453`	B_lectin	19	51	0.0015	19.7
TkA04G418850	`PF07992`	Pyr_redox_2	51	92	0.01	16.0
TkA04G418850	`PF14223`	Retrotran_gag_2	182	296	1.1e-11	45.5
TkA04G418850	`PF22936`	Pol_BBD	231	248	6.2e-15	56.0
TkA04G418850	`PF00727`	IL4	410	459	1.8	9.4
TkA04G418850	`PF00098`	zf-CCHC	418	433	0.00033	21.3
TkA04G418850	`PF14223`	Retrotran_gag_2	480	508	1.1e-11	45.5
TkA04G418850	`PF00727`	IL4	552	607	1.8	9.4
TkA04G418850	`PF25597`	SH3_retrovirus	605	624	3.7e-15	56.2
TkA04G418850	`PF22936`	Pol_BBD	743	818	6.2e-15	56.0
TkA04G418850	`PF13976`	gag_pre-integrs	848	919	6.4e-15	55.4
TkA04G418850	`PF00665`	rve	933	1034	4e-13	50.2
TkA04G418850	`PF29688`	TnsB_C	988	1051	4.2e-07	30.6
TkA04G418850	`PF13683`	rve_3	1023	1058	0.00046	20.6
TkA04G418850	`PF25597`	SH3_retrovirus	1108	1166	3.7e-15	56.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZT94`	Arabidopsis thaliana	sp\|Q9ZT94\|POLR2_ARATH Retrovirus-related Pol polyprotein from transposon RE2	27.600%	Swiss-Prot	Low
`Q94HW2`	Arabidopsis thaliana	sp\|Q94HW2\|POLR1_ARATH Retrovirus-related Pol polyprotein from transposon RE1	27.200%	Swiss-Prot	Low
`A8MS68`	Arabidopsis thaliana	sp\|A8MS68\|PLPD1_ARATH Dihydrolipoyl dehydrogenase 1, chloroplastic	52.600%	Swiss-Prot	Low
`F4JLP5`	Arabidopsis thaliana	sp\|F4JLP5\|PLPD2_ARATH Dihydrolipoyl dehydrogenase 2, chloroplastic	54.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card