TkA04G415850 | RubberDandelionOmics

Gene overview

TkA04G415850

Reference: TK1151 Chr: Chr04 Coordinates: 104733322-104735148 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1031 bp · TkA04G415850|TK1151|cDNA

CAAACTCTCTCTACCGCCCGTCAGATTCTCCCGGTGCCGAAACCTCTGTTTCTCCGATGCTCTACAGGAGACACTTCTCCGCCGCTGTCTGGTGGCTCTGACTTCGATGCCAAAGTTTTCCGGCATAACTTGACTAGAAGCGACAACTACAACCGGAAAGGGTTCGGCCATAAAAAGGAGACTCTCGAACTCATGAATCAAGAGTATACCAGTGACATCATAGAGACGTTGAAGGAGAACAATTATGTATACACATGGGG...

CDS

Download CDS FASTA

1011 bp · TkA04G415850|TK1151|CDS

CAAACTCTCTCTACCGCCCGTCAGATTCTCCCGGTGCCGAAACCTCTGTTTCTCCGATGCTCTACAGGAGACACTTCTCCGCCGCTGTCTGGTGGCTCTGACTTCGATGCCAAAGTTTTCCGGCATAACTTGACTAGAAGCGACAACTACAACCGGAAAGGGTTCGGCCATAAAAAGGAGACTCTCGAACTCATGAATCAAGAGTATACCAGTGACATCATAGAGACGTTGAAGGAGAACAATTATGTATACACATGGGG...

Protein

Download Protein FASTA

336 aa · TkA04G415850|TK1151|PROTEIN

QTLSTARQILPVPKPLFLRCSTGDTSPPLSGGSDFDAKVFRHNLTRSDNYNRKGFGHKKETLELMNQEYTSDIIETLKENNYVYTWGNVTVKLAEAYGFCWGVEHAVRIAYEARKQYPDEKIWITNEIIHNPTVNKRLAEMGFKGFPIKNGEKQFDAIDKGDVVVILPAFGAAVSEMLTLRNKQVRIVDTTCLWVVKVWNSVEKHKKGDYTSIIHGKYAHEETVATASFAGKYVIVKNIDEAKYVCHYILGGELNGSSST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G415850`
TK1151 ID	TkA04G415850
OH-1004 ID	LXL04_038305
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	92.200
Protein coverage (%)	TK1151 99.405 / OH-1004 67.467 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G415850

Location Chr04:104733322-104735148 (-)

Description Similar to ISPH: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34350`	Enzyme of the plastid non-mevalonate pathway for isoprenoid biosynthesis that converts 1-hydroxy-2-methyl-2-(E)-butenyl 4- diphosphate into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).	Characterization of the Arabidopsis clb6 mutant illustrates the importance of posttranscriptional regulation of the methyl-D-erythritol 4-phosphate pathway.2005 · DOI: 10.1105/tpc.104.028860 The Arabidopsis IspH homolog is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis.2005 · DOI: 10.1104/pp.104.058735

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0731900`	Enzyme of the plastid non-mevalonate pathway for isoprenoid biosynthesis that converts 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038305 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0019288 isopentenyl diphosphate biosynthetic process, methylerythritol 4-phosphate pathway Biological Process

GO:0050992 dimethylallyl diphosphate biosynthetic process Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0046429 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase activity (ferredoxin) Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051539 4 iron, 4 sulfur cluster binding Molecular Function

GO:0051745 4-hydroxy-3-methylbut-2-enyl diphosphate reductase activity Molecular Function

KEGG gene cross-reference

ath:AT4G34350

cyt:cce_1108

dosa:Os03g0731900

mar:MAE_16190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.715

Rank 1 · TkA04G415850 · TK1151

Cytoplasm0.135

Rank 2 · TkA04G415850 · TK1151

Plastid0.066

Rank 3 · TkA04G415850 · TK1151

Nucleus0.055

Rank 4 · TkA04G415850 · TK1151

Peroxisome0.045

Rank 5 · TkA04G415850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02401LYTB91-333 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G415850	`PF02401`	LYTB	91	333	3e-45	155.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94B35`	Arabidopsis thaliana	sp\|Q94B35\|ISPH_ARATH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic	74.000%	Swiss-Prot	High
`Q6AVG6`	Oryza sativa subsp. japonica	sp\|Q6AVG6\|ISPH_ORYSJ 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic	74.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card