TkA04G386160 | RubberDandelionOmics

Gene overview

TkA04G386160

Reference: TK1151 Chr: Chr04 Coordinates: 97172646-97174613 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1319 bp · TkA04G386160|TK1151|cDNA

CATCAGAGCTGATTACACGATCCAAAAGAACAAACGGATTACACCAAAACCTTTCTTAAACCCTCCTCTCTCGAAGATAACAACACATAAGCTCAATGATATTCTCCATGACAATTACAACCCCAAGCTTCCCATCTCTACCCCCATTTCACCATTCCAGCTCCCTCCCGCCTTCCTACAAACACCCACCTATCACAATTCATCAAAACCCAGCAAAACCCCATGACAATTCCATAAAATCCCTAAAAAATTCCGGGTTT...

CDS

Download CDS FASTA

1080 bp · TkA04G386160|TK1151|CDS

ATGATATTCTCCATGACAATTACAACCCCAAGCTTCCCATCTCTACCCCCATTTCACCATTCCAGCTCCCTCCCGCCTTCCTACAAACACCCACCTATCACAATTCATCAAAACCCAGCAAAACCCCATGACAATTCCATAAAATCCCTAAAAAATTCCGGGTTTTTATCAGCAATCGGGAACGCAATTGAAGAACAAGAGTATCGAAAAGCTAGGGCTGAGGTTATCCGAAAAGGTACAGGGTTAGAGGGGTATACAAT...

Protein

Download Protein FASTA

359 aa · TkA04G386160|TK1151|PROTEIN

MIFSMTITTPSFPSLPPFHHSSSLPPSYKHPPITIHQNPAKPHDNSIKSLKNSGFLSAIGNAIEEQEYRKARAEVIRKGTGLEGYTIEGLSIGGHETCVIVPELKCAFDIGRCPARAVAMNFLFITHAHLDHIGGLPMYVATRGLYSLTPPTVFVPPAIKDDVENLIELHRKMGNVELNLDLVALDVGETYELRNDLVVRPFKTHHVIPSQGYVIYSVRKKLKKQYTHLKGREIEKKKKSGVEITDIILSPEIAFTGDTS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G386160`
TK1151 ID	TkA04G386160
OH-1004 ID	LXL04_038069
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G386160

Location Chr04:97172646-97174613 (+)

Description Similar to TRZ2: tRNase Z TRZ2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04530`	Zinc phosphodiesterase, which displays tRNA 3'-processing endonuclease activity.	No verified direct reference in this release
`At1g74700`	Zinc phosphodiesterase, which displays tRNA 3'-processing endonuclease activity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038069 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008033 tRNA processing Biological Process

GO:0042780 tRNA 3'-end processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0042781 3'-tRNA processing endoribonuclease activity Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G74700

ath:AT2G04530

hal:VNG_2239C

hsl:OE_4141R

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.932

Rank 1 · TkA04G386160 · TK1151

Mitochondrion0.074

Rank 2 · TkA04G386160 · TK1151

Nucleus0.032

Rank 3 · TkA04G386160 · TK1151

Cytoplasm0.032

Rank 4 · TkA04G386160 · TK1151

Peroxisome0.016

Rank 5 · TkA04G386160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12706Lactamase_B_2118-322 aa

PF23023Anti-Pycsar_Apyc1120-326 aa

PF00753Lactamase_B123-151 aa

PF02112PDEase_II123-137 aa

PF00753Lactamase_B252-261 aa

PF02112PDEase_II316-340 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G386160	`PF12706`	Lactamase_B_2	118	322	5.6e-12	46.4
TkA04G386160	`PF23023`	Anti-Pycsar_Apyc1	120	326	1.8e-09	38.4
TkA04G386160	`PF00753`	Lactamase_B	123	151	0.00015	22.5
TkA04G386160	`PF02112`	PDEase_II	123	137	0.019	14.8
TkA04G386160	`PF00753`	Lactamase_B	252	261	0.00015	22.5
TkA04G386160	`PF02112`	PDEase_II	316	340	0.019	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L633`	Arabidopsis thaliana	sp\|Q8L633\|RNZ2_ARATH tRNase Z TRZ2, chloroplastic	71.200%	Swiss-Prot	High
`Q8LGU7`	Arabidopsis thaliana	sp\|Q8LGU7\|RNZ1_ARATH tRNase Z TRZ1	57.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card