TkA04G373080 | RubberDandelionOmics

Gene overview

TkA04G373080

Reference: TK1151 Chr: Chr04 Coordinates: 93734771-93739981 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2568 bp · TkA04G373080|TK1151|cDNA

ATTGTCACAATATCGTTTTCGGAACCATTTAACTACAAATTAAATGGATGTAACCCCTTCACAAATGTGATGATATCATGGCCTCATGGGGGTATCCGTGTACTGGCGTACACCAATCTCCAGCAATCCTAAACCCTCAAAAAACCCCGTCACTGAATCCTTCAAGAACACAAACCCAAATTCATTTTTTCATCTAATTTTTATATATTTTTCTCACATACTAGGTCACCACCAAACGCACACACAACCATGAATTCAAC...

CDS

Download CDS FASTA

1944 bp · TkA04G373080|TK1151|CDS

ATGAATTCAACACTTCTCAGAACATCACCATTCATCCATTGTTGTCGCCCTTTACGCTCTTCAAGAATTCCGGAGCTCTTTCCCCCCTTTCGGTACCATATCAATTCGAAAACATTATGGAAACAAAAGCTTCAGATTTCACGACGCTCCAATTTCTTTATCACCAAAGTATACCCCAAGAATTCCGTAGCCAGAGAAATTGTACCCGAAGAATCTACCCAAGATTCGTCAAGAAAAGAGGATTTCGAGAAGTTTGGGGG...

Protein

Download Protein FASTA

647 aa · TkA04G373080|TK1151|PROTEIN

MNSTLLRTSPFIHCCRPLRSSRIPELFPPFRYHINSKTLWKQKLQISRRSNFFITKVYPKNSVAREIVPEESTQDSSRKEDFEKFGGLLRCGLLLGLLVLGVIRCQKALALDAGSDLGVLTQTAIVHTQGFWNNPKIPQIFRVFREQGLILAALLGLSAFFSMAETSITTLSPWKVRELAEKEDENGVFKLLRTDITRFLTTILIGTTVVNIGATALFTEAATTVFGEAGVSAATGVMTVVVLLLTEITPKSIAVHNATA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G373080`
TK1151 ID	TkA04G373080
OH-1004 ID	LXL04_037997
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 99.845 / OH-1004 99.846 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G373080

Location Chr04:93734771-93739981 (+)

Description Similar to CBSDUFCH2: DUF21 domain-containing protein At1g55930, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g13070`	Putative DUF21 domain-containing protein At3g13070, chloroplastic.	No verified direct reference in this release
`At1g55930`	DUF21 domain-containing protein At1g55930, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037997 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0050660 flavin adenine dinucleotide binding Molecular Function

KEGG gene cross-reference

ath:AT1G55930

ath:AT3G13070

mbo:BQ2027_MB2387C

mtc:MT2435

mtu:Rv2366c

mtv:RVBD_2366c

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.957

Rank 1 · TkA04G373080 · TK1151

Mitochondrion0.033

Rank 2 · TkA04G373080 · TK1151

Cytoplasm0.019

Rank 3 · TkA04G373080 · TK1151

Cell membrane0.018

Rank 4 · TkA04G373080 · TK1151

Endoplasmic reticulum0.018

Rank 5 · TkA04G373080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01595CNNM149-326 aa

PF00571CBS341-398 aa

PF00571CBS409-464 aa

PF03471CorC_HlyC486-588 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G373080	`PF01595`	CNNM	149	326	1.6e-47	162.2
TkA04G373080	`PF00571`	CBS	341	398	7.5e-14	52.5
TkA04G373080	`PF00571`	CBS	409	464	7.5e-14	52.5
TkA04G373080	`PF03471`	CorC_HlyC	486	588	1.1e-14	54.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK65`	Arabidopsis thaliana	sp\|Q9LK65\|Y3307_ARATH Putative DUF21 domain-containing protein At3g13070, chloroplastic	65.100%	Swiss-Prot	High
`Q84R21`	Arabidopsis thaliana	sp\|Q84R21\|Y1559_ARATH DUF21 domain-containing protein At1g55930, chloroplastic	69.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card