TkA04G366880 | RubberDandelionOmics

Gene overview

TkA04G366880

Reference: TK1151 Chr: Chr04 Coordinates: 92209952-92216711 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2158 bp · TkA04G366880|TK1151|cDNA

TTCTTTCTCTTTTCTTTTTCCGCTCGACTTCTTGCCGAGTTCAATCGTTATGCCCGTAGGCCTCCTTTTCTCTGCCTACAAATACATTCTTTTTTCATTCTACTTCTCATACATCAACTTCTTTCTTCACTCTTCTGTTAGCTTCTGGATTCACATTCTGAAGTTTCCTTTGCTTCTCTTAAGGTGTTTTCCGATCAGGGTTTCAAAGACTTTCTGTTGACTTCACGATTCTTGATCCAAATATCAGAGATATTATTAAA...

CDS

Download CDS FASTA

903 bp · TkA04G366880|TK1151|CDS

ATGAGGACGAAAGTATTTGTATCAAGTTTTATACTATTGATGCAATTACAGATCATTTCCACCTCTCGATTATTGCAGACGGAGCCTTGTGAAACATTAAATATCCACTATTCCGGTAACGACTTGTATTACTTGAATGGTGAATTGGTAAATAAAGATTCGTTTTGCAAGTTTATCAAATTATACCATGCAAATCAATGCTTCATTAGTCGAAACCTCGTCAATCAATGCTTTGAGGAAGATCGTATTTTAGATGGTTT...

Protein

Download Protein FASTA

300 aa · TkA04G366880|TK1151|PROTEIN

MRTKVFVSSFILLMQLQIISTSRLLQTEPCETLNIHYSGNDLYYLNGELVNKDSFCKFIKLYHANQCFISRNLVNQCFEEDRILDGLHVEAGRRVLHDLVIKENKKTSFKPKYIAMGGTGMLLLCCTLLCPCFRSKRKDPDEAAIVKESNSLEKAPSVEMNSVSGKIPASPLRVPPSPGRFSMSPKLDRIGSVHLTMNQVARATQNFSPSLKLGEGGFGTVYKAQLQDGQLVAIKRASKEHFDALRGEFKSEIELLAKIE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G366880`
TK1151 ID	TkA04G366880
OH-1004 ID	LXL04_002738
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.667 / OH-1004 60.772 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G366880

Location Chr04:92209952-92216711 (+)

Description Similar to CRCK3: Calmodulin-binding receptor-like cytoplasmic kinase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g11520`	Calmodulin-binding receptor-like cytoplasmic kinase 3.	No verified direct reference in this release
`At5g58940`	Calmodulin-binding receptor-like cytoplasmic kinase 1.	No verified direct reference in this release
`At4g00330`	Calmodulin-binding receptor-like cytoplasmic kinase 2.	No verified direct reference in this release
`At1g30570`	Probable receptor-like protein kinase At1g30570.	No verified direct reference in this release
`At2g01820`	Involved in auxin signal transduction and cell expansion and proliferation regulation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002738 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009555 pollen development Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G11520

ath:AT3G46290

ath:AT4G00330

ath:AT5G58940

ath:AT5G59700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.792

Rank 1 · TkA04G366880 · TK1151

Endoplasmic reticulum0.113

Rank 2 · TkA04G366880 · TK1151

Cytoplasm0.090

Rank 3 · TkA04G366880 · TK1151

Nucleus0.070

Rank 4 · TkA04G366880 · TK1151

Extracellular0.043

Rank 5 · TkA04G366880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase40-89 aa

PF00069Pkinase120-154 aa

PF07714PK_Tyr_Ser-Thr212-294 aa

PF00069Pkinase212-294 aa

PF03109ABC1217-239 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G366880	`PF00069`	Pkinase	40	89	7.1e-16	59.1
TkA04G366880	`PF00069`	Pkinase	120	154	7.1e-16	59.1
TkA04G366880	`PF07714`	PK_Tyr_Ser-Thr	212	294	2.5e-16	60.5
TkA04G366880	`PF00069`	Pkinase	212	294	7.1e-16	59.1
TkA04G366880	`PF03109`	ABC1	217	239	0.06	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASQ5`	Arabidopsis thaliana	sp\|Q9ASQ5\|CRCK3_ARATH Calmodulin-binding receptor-like cytoplasmic kinase 3	43.800%	Swiss-Prot	Medium
`Q9FIL7`	Arabidopsis thaliana	sp\|Q9FIL7\|CRCK1_ARATH Calmodulin-binding receptor-like cytoplasmic kinase 1	51.600%	Swiss-Prot	Low
`Q8VZJ9`	Arabidopsis thaliana	sp\|Q8VZJ9\|CRCK2_ARATH Calmodulin-binding receptor-like cytoplasmic kinase 2	50.000%	Swiss-Prot	Low
`Q9SA72`	Arabidopsis thaliana	sp\|Q9SA72\|Y1357_ARATH Probable receptor-like protein kinase At1g30570	46.900%	Swiss-Prot	Low
`Q9SIT1`	Arabidopsis thaliana	sp\|Q9SIT1\|TMK3_ARATH Receptor-like kinase TMK3	50.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card