TkA04G353960 | RubberDandelionOmics

Gene overview

TkA04G353960

Reference: TK1151 Chr: Chr04 Coordinates: 89282869-89287475 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3045 bp · TkA04G353960|TK1151|cDNA

ATTTATTTTCGGCAAACAGCCATATACAAACAAATTTTATATTTTTTCAGTTGTGAATATATACCCTATTATCTATACAAGATAAGTATCTTTTAGTAAAAATTTTATGGTTTTATAGACATTTAATATGTTGGATAAGTTCTAACTTAGAGTCTGTGATATTAAAAATTAAAATGGTAATCAAATTCTTTCGGTATACACGATTATACGCTTTACCAATTTGGGTGATACACTGAGTCAGAGACCCAATCCAAACGGTG...

CDS

Download CDS FASTA

1566 bp · TkA04G353960|TK1151|CDS

ATGCTGCCACCATCGAGACGCGAGTTTAAAGATATTTATGTAGTATTCGAACTCATGGAGTCTGATCTTCACCAAGTCATTAAAGCCAATGACGACTTAACTCACGAACACCATCGGTTTTTTCTATATCAAATGCTTCGAGCATTAAAGTACATGCATACAGCAAATGTATATCATCGAGATTTAAAACCAAAGAACATATTAGCAAATGCTAATTGCAAACTCAAGATTTGCGACTTTGGACTAGCAAGAGCTGCTTT...

Protein

Download Protein FASTA

521 aa · TkA04G353960|TK1151|PROTEIN

MLPPSRREFKDIYVVFELMESDLHQVIKANDDLTHEHHRFFLYQMLRALKYMHTANVYHRDLKPKNILANANCKLKICDFGLARAAFTDTPTTIFWTDYVATRWYRAPELCGSFYSKYTPAVDIWGIGCIFAEVLTGKPLFPGKSVVHQLELITDLLGTPSSDTISRVRNDKARKYLTDMRKKKPVTFSEKFLEVDPLALRLLQRLLAFDPKDRPTAEQALADPYFKGLSKVEREPSCQSFSKLEFEFERRRVTKEDIRE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G353960`
TK1151 ID	TkA04G353960
OH-1004 ID	LXL04_037820
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 85.270 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G353960

Location Chr04:89282869-89287475 (+)

Description Similar to MPK18: Mitogen-activated protein kinase 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g53510`	Mitogen-activated protein kinase (MAPK) that is specifically regulated by PHS1 and MAPKKK20 and mediates signaling that regulates cortical microtubule functions, maybe through regulation of microtubule dynamic instability.	Arabidopsis mitogen-activated protein kinase MPK18 mediates cortical microtubule functions in plant cells.2009 · DOI: 10.1111/j.1365-313x.2009.03895.x The Arabidopsis Mitogen-Activated Protein Kinase Kinase Kinase 20 (MKKK20) Acts Upstream of MKK3 and MPK18 in Two Separate Signaling Pathways Involved in Root Microtubule Functions.2017 · DOI: 10.3389/fpls.2017.01352
`At3g14720`	Mitogen-activated protein kinase 19.	No verified direct reference in this release
`At2g42880`	Mitogen-activated protein kinase 20.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0629900`	Mitogen-activated protein kinase 10.	No verified direct reference in this release
`Os01g0665200`	Mitogen-activated protein kinase 8.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037820 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004707 MAP kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G53510

ath:AT2G42880

ath:AT3G14720

dosa:Os01g0629900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.668

Rank 1 · TkA04G353960 · TK1151

Nucleus0.279

Rank 2 · TkA04G353960 · TK1151

Cell membrane0.138

Rank 3 · TkA04G353960 · TK1151

Golgi apparatus0.050

Rank 4 · TkA04G353960 · TK1151

Lysosome / Vacuole0.050

Rank 5 · TkA04G353960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase9-226 aa

PF07714PK_Tyr_Ser-Thr10-153 aa

PF14531Kinase-like17-129 aa

PF06293Kdo21-78 aa

PF12330Haspin_kinase43-98 aa

PF03109ABC149-86 aa

PF06293Kdo239-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G353960	`PF00069`	Pkinase	9	226	7.7e-49	167.2
TkA04G353960	`PF07714`	PK_Tyr_Ser-Thr	10	153	4e-20	72.9
TkA04G353960	`PF14531`	Kinase-like	17	129	0.011	15.7
TkA04G353960	`PF06293`	Kdo	21	78	5.3e-05	23.5
TkA04G353960	`PF12330`	Haspin_kinase	43	98	0.0012	18.7
TkA04G353960	`PF03109`	ABC1	49	86	0.098	12.5
TkA04G353960	`PF06293`	Kdo	239	262	5.3e-05	23.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5C0`	Arabidopsis thaliana	sp\|Q9C5C0\|MPK18_ARATH Mitogen-activated protein kinase 18	69.800%	Swiss-Prot	High
`Q9LUC3`	Arabidopsis thaliana	sp\|Q9LUC3\|MPK19_ARATH Mitogen-activated protein kinase 19	63.000%	Swiss-Prot	High
`Q9SJG9`	Arabidopsis thaliana	sp\|Q9SJG9\|MPK20_ARATH Mitogen-activated protein kinase 20	69.400%	Swiss-Prot	High
`Q5ZCI1`	Oryza sativa subsp. japonica	sp\|Q5ZCI1\|MPK10_ORYSJ Mitogen-activated protein kinase 10	69.400%	Swiss-Prot	High
`Q5SN53`	Oryza sativa subsp. japonica	sp\|Q5SN53\|MPK8_ORYSJ Mitogen-activated protein kinase 8	79.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card