TkA04G320460 | RubberDandelionOmics

Gene overview

TkA04G320460

Reference: TK1151 Chr: Chr04 Coordinates: 80950364-80952025 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

597 bp · TkA04G320460|TK1151|cDNA

ATTACTTTGCTCAGGTTAAGTGAGATCCAATGGGCTGCTTTTATTCTACTTTGTGCGGGTTGCACAACAGCACAACTTAATCCTTCATCTGATCATGTTCTTCAGACTCCTTTCCTAGGTTGGATGATGGCCATTGTTATGGCACTGTTAAGTGGTTTTGCTGGAGTGTACACAGAGGCTATAATAAAGAAACGACCTTCAAGGAACATAAATGTGCAGAATTTCTGGTTATATGTGTTTGGGATGGCTTTTAATGTTGT...

CDS

Download CDS FASTA

597 bp · TkA04G320460|TK1151|CDS

ATTACTTTGCTCAGGTTAAGTGAGATCCAATGGGCTGCTTTTATTCTACTTTGTGCGGGTTGCACAACAGCACAACTTAATCCTTCATCTGATCATGTTCTTCAGACTCCTTTCCTAGGTTGGATGATGGCCATTGTTATGGCACTGTTAAGTGGTTTTGCTGGAGTGTACACAGAGGCTATAATAAAGAAACGACCTTCAAGGAACATAAATGTGCAGAATTTCTGGTTATATGTGTTTGGGATGGCTTTTAATGTTGT...

Protein

Download Protein FASTA

198 aa · TkA04G320460|TK1151|PROTEIN

ITLLRLSEIQWAAFILLCAGCTTAQLNPSSDHVLQTPFLGWMMAIVMALLSGFAGVYTEAIIKKRPSRNINVQNFWLYVFGMAFNVVAIIVQTVMCRGFFHGYSLITVLMIINHALSGIAKYADNMVKVYFMDEQIWYAIFATIIDGILVPLVTWARSLTWWKRTRTCEDGSKTNFVRIRKQPRRRSTYSNDECPISY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G320460`
TK1151 ID	TkA04G320460
OH-1004 ID	LXL04_019557
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	89.600
Protein coverage (%)	TK1151 63.636 / OH-1004 38.841 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G320460

Location Chr04:80950364-80952025 (-)

Description Similar to CSTLP2: CMP-sialic acid transporter 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35335`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8B7Q4`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`Os07g0573700`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi (By similarity).	Analysis of CMP-sialic acid transporter-like proteins in plants.2009 · DOI: 10.1016/j.phytochem.2009.09.017

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019557 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015739 sialic acid transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0015136 sialic acid transmembrane transporter activity Molecular Function

GO:0015165 pyrimidine nucleotide-sugar transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

dosa:Os06g0523400

dosa:Os07g0573700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.342

Rank 1 · TkA04G320460 · TK1151

Golgi apparatus0.332

Rank 2 · TkA04G320460 · TK1151

Cytoplasm0.154

Rank 3 · TkA04G320460 · TK1151

Cell membrane0.150

Rank 4 · TkA04G320460 · TK1151

Lysosome / Vacuole0.146

Rank 5 · TkA04G320460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04142Nuc_sug_transp5-136 aa

PF13073DUF3937101-153 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G320460	`PF04142`	Nuc_sug_transp	5	136	1.4e-19	71.1
TkA04G320460	`PF13073`	DUF3937	101	153	0.01	16.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JN00`	Arabidopsis thaliana	sp\|F4JN00\|CSTR4_ARATH CMP-sialic acid transporter 4	78.400%	Swiss-Prot	Medium
`B8B7Q4`	Oryza sativa subsp. indica	sp\|B8B7Q4\|CSTR2_ORYSI CMP-sialic acid transporter 2	83.600%	Swiss-Prot	Medium
`Q6ZL17`	Oryza sativa subsp. japonica	sp\|Q6ZL17\|CSTR2_ORYSJ CMP-sialic acid transporter 2	83.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card