TkA04G309110 | RubberDandelionOmics

Gene overview

TkA04G309110

Reference: TK1151 Chr: Chr04 Coordinates: 77984003-77985619 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1383 bp · TkA04G309110|TK1151|cDNA

ATGAGCGAAAACAAAACCCACGGCCAACATGAAATTGGAGATATAAGTGATTTGGTCGATCATATTAGCAGTCTACCCGATTGTATTCTTCATCACATTTTGTCGTTTATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCAAGAAGATGGAAGAACGAAAACCTCTGGGTTTTTGCTTCCAAAATTGATTTTGATGATGATTTGTTGTTTTCTAGAGAGGTTCACGGTTGGCATCTACCTGACGTCACTTCCTT...

CDS

Download CDS FASTA

1383 bp · TkA04G309110|TK1151|CDS

ATGAGCGAAAACAAAACCCACGGCCAACATGAAATTGGAGATATAAGTGATTTGGTCGATCATATTAGCAGTCTACCCGATTGTATTCTTCATCACATTTTGTCGTTTATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCAAGAAGATGGAAGAACGAAAACCTCTGGGTTTTTGCTTCCAAAATTGATTTTGATGATGATTTGTTGTTTTCTAGAGAGGTTCACGGTTGGCATCTACCTGACGTCACTTCCTT...

Protein

Download Protein FASTA

460 aa · TkA04G309110|TK1151|PROTEIN

MSENKTHGQHEIGDISDLVDHISSLPDCILHHILSFMPTKEAVKTSILSRRWKNENLWVFASKIDFDDDLLFSREVHGWHLPDVTSFVNLVERFFQLRNALNLEKFRLTCRGCYHESRIHSWISNAIMHNVQELDLTFRSAGRSMIPWSMLYRTSLVTLKIRMSCITELPSHFSFPCLKTFHLASIRFLNDDCTEETFLGCPVLRELVLLDCKWMSSQNIAISSSTLKSLTINDLLSFNPSYDSMICFIKIDATNLTYFE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G309110`
TK1151 ID	TkA04G309110
OH-1004 ID	LXL04_037445
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G309110

Location Chr04:77984003-77985619 (-)

Description Similar to At3g59240: Putative F-box/FBD/LRR-repeat protein At3g59240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59240`	Putative F-box/FBD/LRR-repeat protein At3g59240.	No verified direct reference in this release
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At3g59000`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release
`At3g59230`	Putative F-box/LRR-repeat protein At3g59230.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037445 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference

ath:AT3G58860

ath:AT3G59210

ath:AT3G59230

ath:AT3G59240

ath:AT4G14096

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.804

Rank 1 · TkA04G309110 · TK1151

Cytoplasm0.264

Rank 2 · TkA04G309110 · TK1151

Cell membrane0.038

Rank 3 · TkA04G309110 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA04G309110 · TK1151

Plastid0.018

Rank 5 · TkA04G309110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box22-54 aa

PF12937F-box-like22-53 aa

PF08387FBD23-33 aa

PF08387FBD97-106 aa

PF23622LRR_At1g61320_AtMIF1102-429 aa

PF00646F-box103-114 aa

PF12799LRR_4128-137 aa

PF12799LRR_4154-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G309110	`PF00646`	F-box	22	54	1.3e-09	38.3
TkA04G309110	`PF12937`	F-box-like	22	53	0.00065	20.1
TkA04G309110	`PF08387`	FBD	23	33	2.4e-06	28.0
TkA04G309110	`PF08387`	FBD	97	106	2.4e-06	28.0
TkA04G309110	`PF23622`	LRR_At1g61320_AtMIF1	102	429	4.4e-12	46.8
TkA04G309110	`PF00646`	F-box	103	114	1.3e-09	38.3
TkA04G309110	`PF12799`	LRR_4	128	137	0.022	15.7
TkA04G309110	`PF12799`	LRR_4	154	185	0.022	15.7
TkA04G309110	`PF12799`	LRR_4	198	212	0.022	15.7
TkA04G309110	`PF08387`	FBD	224	232	2.4e-06	28.0
TkA04G309110	`PF12799`	LRR_4	227	230	0.022	15.7
TkA04G309110	`PF08387`	FBD	255	266	2.4e-06	28.0
TkA04G309110	`PF12799`	LRR_4	299	320	0.022	15.7
TkA04G309110	`PF12799`	LRR_4	355	368	0.022	15.7
TkA04G309110	`PF00646`	F-box	385	403	1.3e-09	38.3
TkA04G309110	`PF08387`	FBD	387	428	2.4e-06	28.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX47`	Arabidopsis thaliana	sp\|Q9LX47\|FDL46_ARATH Putative F-box/FBD/LRR-repeat protein At3g59240	29.200%	Swiss-Prot	Low
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	27.400%	Swiss-Prot	Low
`Q2V3N5`	Arabidopsis thaliana	sp\|Q2V3N5\|FB211_ARATH F-box protein At3g59000	27.900%	Swiss-Prot	Low
`Q9LXR6`	Arabidopsis thaliana	sp\|Q9LXR6\|FB207_ARATH Putative F-box protein At3g58860	27.500%	Swiss-Prot	Low
`Q9LX48`	Arabidopsis thaliana	sp\|Q9LX48\|FBL66_ARATH Putative F-box/LRR-repeat protein At3g59230	28.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card