TkA04G259110 | RubberDandelionOmics

Gene overview

TkA04G259110

Reference: TK1151 Chr: Chr04 Coordinates: 65506677-65507441 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

765 bp · TkA04G259110|TK1151|cDNA

ATGCACGGCGTTCAGTGGCCGCCGTTAATGCAAGCGATCGCCGAGCGGTACCCTACTCCGACTCCGACTCTCCGCATCACCTCTACCGGCACCGACCTCGATAACCTTCGAAGAACCGGCGATCGTCTCTCCAACTTCGCTCATTCCCTTAATCTCAATTTCCGATTCCACCCCCTCGTAGTTCCAAACGAAGACAATGTCGACGACATTATCTACCGCCTCTCCGCCGTCATCCTCCTCCCTAATGAAATTCTAGCGGT...

CDS

Download CDS FASTA

765 bp · TkA04G259110|TK1151|CDS

ATGCACGGCGTTCAGTGGCCGCCGTTAATGCAAGCGATCGCCGAGCGGTACCCTACTCCGACTCCGACTCTCCGCATCACCTCTACCGGCACCGACCTCGATAACCTTCGAAGAACCGGCGATCGTCTCTCCAACTTCGCTCATTCCCTTAATCTCAATTTCCGATTCCACCCCCTCGTAGTTCCAAACGAAGACAATGTCGACGACATTATCTACCGCCTCTCCGCCGTCATCCTCCTCCCTAATGAAATTCTAGCGGT...

Protein

Download Protein FASTA

254 aa · TkA04G259110|TK1151|PROTEIN

MHGVQWPPLMQAIAERYPTPTPTLRITSTGTDLDNLRRTGDRLSNFAHSLNLNFRFHPLVVPNEDNVDDIIYRLSAVILLPNEILAVNCVLYLHRLLKDRESFLLLLRKIKTMNPKVVTLAEKEANYNNPLFLSRFSEAVNYYTAVFDSLEATLPPNSRERMEVEQVWFGREIADVVAAEGEKRRERHERFRSWEVVMRSAGFSNFPVSGFAVAQAKLLLRLHYPSEGYSLQVLNDCFFLGWQNQPLFSVSAWH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G259110`
TK1151 ID	TkA04G259110
OH-1004 ID	LXL04_037220
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 59.624 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G259110

Location Chr04:65506677-65507441 (-)

Description Similar to SCL18: Scarecrow-like protein 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55580`	Probable transcription factor required for axillary (lateral) shoot meristem formation during vegetative development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0610300`	Putative transcription regulator that controls rice tillering by initiating axillary buds and promoting their outgrowth.	Control of tillering in rice.2003 · DOI: 10.1038/nature01518

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037220 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0007584 response to nutrient Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0010014 meristem initiation Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0010247 detection of phosphate ion Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0090506 axillary shoot meristem initiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G55580

mtr:11438339

osa:107278653

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.567

Rank 1 · TkA04G259110 · TK1151

Cytoplasm0.478

Rank 2 · TkA04G259110 · TK1151

Cell membrane0.045

Rank 3 · TkA04G259110 · TK1151

Endoplasmic reticulum0.034

Rank 4 · TkA04G259110 · TK1151

Mitochondrion0.033

Rank 5 · TkA04G259110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514GRAS1-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G259110	`PF03514`	GRAS	1	253	4.9e-85	286.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZWC5`	Arabidopsis thaliana	sp\|Q9ZWC5\|SCL18_ARATH Scarecrow-like protein 18	57.000%	Swiss-Prot	High
`Q84MM9`	Oryza sativa subsp. japonica	sp\|Q84MM9\|MOC_ORYSJ Protein MONOCULM 1	44.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card