TkA04G258590 | RubberDandelionOmics

Gene overview

TkA04G258590

Reference: TK1151 Chr: Chr04 Coordinates: 65356277-65359002 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1087 bp · TkA04G258590|TK1151|cDNA

AAACTTCTCTGCAATAAGATTTGTAAAGAGAGGAGAGGGCTGAGGTGGGAAATCAAAAGCGAAAATTGCCAAAAATTTCTGCCAAGAAATTACTTCTTTAATCCAATGGAAACCTGTTAATCACAGAGAATCAACTAATCAGAGGAGACAAAAGGGTCTCCTTTGTTATTAGCTTACCCTTGACTGTCTGTCTGTGTTCTTTTCCAGCAGATAATCAGGGAAGAAAGCTTTTCGATTGATGGGTGGATTCGACGATCATG...

CDS

Download CDS FASTA

849 bp · TkA04G258590|TK1151|CDS

ATGGGTGGATTCGACGATCATGGTGGAATAATCGGCGATTGGATGCCTCCAAGCCCTAGCCCACGATCTCTTTTCGCATCCATGTTAGGCGAAGACCCTGGTTCACGATCAGTACCCGATTCTCAAAAACACGACACGGGGTTCACCTTCGATCAACAAATTAGGTCTGAAAACGATGACGCGACAAAATCAAGTGAGTTTATCGATCAGAAATCAAGCTCGAGGGCAGGTCTGGTTGAAAGAATGGCGGCAAGGGCGGG...

Protein

Download Protein FASTA

282 aa · TkA04G258590|TK1151|PROTEIN

MGGFDDHGGIIGDWMPPSPSPRSLFASMLGEDPGSRSVPDSQKHDTGFTFDQQIRSENDDATKSSEFIDQKSSSRAGLVERMAARAGHNAPRLNTEIIKSSDNNSSQNQQTQLPFVSFSPGVSPSSFLESPIFLSNSLVQPSPTTESSNLVQMGMIMNNNNNNTSFAFKPFPDSASVPRDHSTQSFQTQETLPQSERQFPPHKIEPNQEPQQHNHNHDDDTSDQRTNGEIGNSNNSSSEDGYNWRKYGQKQVKGSEYPRS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G258590`
TK1151 ID	TkA04G258590
OH-1004 ID	LXL04_037227
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	86.200
Protein coverage (%)	TK1151 92.199 / OH-1004 45.016 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G258590

Location Chr04:65356277-65359002 (-)

Description Similar to WRKY2: Probable WRKY transcription factor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56270`	Transcription factor.	Transcriptional activation of Arabidopsis axis patterning genes WOX8/9 links zygote polarity to embryo development.2011 · DOI: 10.1016/j.devcel.2011.01.009
`At4g26440`	Transcription factor.	No verified direct reference in this release
`At4g26640`	Transcription factor.	No verified direct reference in this release
`At3g01080`	Transcription factor.	No verified direct reference in this release
`At2g37260`	Transcription factor.	TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor.2002 · DOI: 10.1105/tpc.001404

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037227 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009409 response to cold Biological Process

GO:0009555 pollen development Biological Process

GO:0009611 response to wounding Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009846 pollen germination Biological Process

KEGG gene cross-reference

ath:AT4G26440

ath:AT4G26640

ath:AT5G56270

dosa:Os01g0826400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · TkA04G258590 · TK1151

Cytoplasm0.105

Rank 2 · TkA04G258590 · TK1151

Cell membrane0.028

Rank 3 · TkA04G258590 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkA04G258590 · TK1151

Plastid0.014

Rank 5 · TkA04G258590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106WRKY212-216 aa

PF03106WRKY239-274 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G258590	`PF03106`	WRKY	212	216	2.9e-17	63.3
TkA04G258590	`PF03106`	WRKY	239	274	2.9e-17	63.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FG77`	Arabidopsis thaliana	sp\|Q9FG77\|WRKY2_ARATH Probable WRKY transcription factor 2	37.300%	Swiss-Prot	Medium
`O65590`	Arabidopsis thaliana	sp\|O65590\|WRK34_ARATH Probable WRKY transcription factor 34	38.700%	Swiss-Prot	Medium
`Q93WV0`	Arabidopsis thaliana	sp\|Q93WV0\|WRK20_ARATH Probable WRKY transcription factor 20	35.400%	Swiss-Prot	Medium
`Q93WU7`	Arabidopsis thaliana	sp\|Q93WU7\|WRK58_ARATH Probable WRKY transcription factor 58	83.300%	Swiss-Prot	Low
`Q9ZUU0`	Arabidopsis thaliana	sp\|Q9ZUU0\|WRK44_ARATH WRKY transcription factor 44	86.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card