TkA04G220860 | RubberDandelionOmics

Gene overview

TkA04G220860

Reference: TK1151 Chr: Chr04 Coordinates: 56286416-56295093 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1014 bp · TkA04G220860|TK1151|cDNA

ATGACAAGATTGGCAAAGCTACGCACAAACTATACCAGATCGGGTGGGAAAAAGAAACATGTAAAGTTTGATGAATTGGGCAGGTTTTCAGGGAAAAATAGGCCATTGTTTGTGAGATTTTTGGGAGATGTTGTCCGACAGAGGGTGGGAATACGTGTCTATTCGTGGAAGGCTGTAACCTCGGAGTTCAGGCACAAACTATGGGAAGAGCTGACGCGGTTTTTTGTTGTTGATGAAAGTCGAAGAAAATTCGTGATGAA...

CDS

Download CDS FASTA

1014 bp · TkA04G220860|TK1151|CDS

ATGACAAGATTGGCAAAGCTACGCACAAACTATACCAGATCGGGTGGGAAAAAGAAACATGTAAAGTTTGATGAATTGGGCAGGTTTTCAGGGAAAAATAGGCCATTGTTTGTGAGATTTTTGGGAGATGTTGTCCGACAGAGGGTGGGAATACGTGTCTATTCGTGGAAGGCTGTAACCTCGGAGTTCAGGCACAAACTATGGGAAGAGCTGACGCGGTTTTTTGTTGTTGATGAAAGTCGAAGAAAATTCGTGATGAA...

Protein

Download Protein FASTA

337 aa · TkA04G220860|TK1151|PROTEIN

MTRLAKLRTNYTRSGGKKKHVKFDELGRFSGKNRPLFVRFLGDVVRQRVGIRVYSWKAVTSEFRHKLWEELTRFFVVDESRRKFVMNRMGMLLRNFRRKVYAKYIKPNLGNPTKLAKIPRCYRTLLKDQDDWNNFVTYTLSENFNDVSQRTIEARKHLTYSHRLGRWGYTTLREKLVANNEIGKDELPPRSFMWCKGREDKECEIKEDNVKLIADKLMESEQQIKDGKVILESGTNAMSLVFGQEKGRFLKGVGTGLTAT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G220860`
TK1151 ID	TkA04G220860
OH-1004 ID	LXL04_020682
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.800
Protein coverage (%)	TK1151 82.789 / OH-1004 67.883 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G220860`
Location	Chr04:56286416-56295093 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020682` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.949

Rank 1 · TkA04G220860 · TK1151

Cytoplasm0.108

Rank 2 · TkA04G220860 · TK1151

Mitochondrion0.020

Rank 3 · TkA04G220860 · TK1151

Cell membrane0.014

Rank 4 · TkA04G220860 · TK1151

Extracellular0.012

Rank 5 · TkA04G220860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25238OGFOD2-like51-96 aa

PF02485Branch75-198 aa

PF03004Transposase_24128-255 aa

PF21354STAT_linker131-192 aa

PF21354STAT_linker202-228 aa

PF16516CC2-LZ207-223 aa

PF00038Filament271-320 aa

PF01519DUF16271-327 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G220860	`PF25238`	OGFOD2-like	51	96	0.053	14.2
TkA04G220860	`PF02485`	Branch	75	198	0.031	14.6
TkA04G220860	`PF03004`	Transposase_24	128	255	3.7e-06	27.9
TkA04G220860	`PF21354`	STAT_linker	131	192	0.15	13.2
TkA04G220860	`PF21354`	STAT_linker	202	228	0.15	13.2
TkA04G220860	`PF16516`	CC2-LZ	207	223	2.6	9.3
TkA04G220860	`PF00038`	Filament	271	320	0.0018	18.7
TkA04G220860	`PF01519`	DUF16	271	327	0.59	11.4
TkA04G220860	`PF16516`	CC2-LZ	271	312	2.6	9.3
TkA04G220860	`PF03004`	Transposase_24	285	302	3.7e-06	27.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card