TkA04G204340 | RubberDandelionOmics

Gene overview

TkA04G204340

Reference: TK1151 Chr: Chr04 Coordinates: 52497470-52505679 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1968 bp · TkA04G204340|TK1151|cDNA

TCATTAAATGTCTATCTTATTTTTTGTAGCTATATATTATCCATATAATATCCAATCTCTTTCCAATCTAAAATATCATTTTTCAAACTCCCATATCACCCAACTCAACCCATCAACCATTCTGCTAGATAAAGGAGAGAGAAGGGAATTGTTGAGAGAGATACAGGGGAGATATATAGATACACACGTACAAGAGATATGGATGAGGGCGTCGTTCAAAAGAGGCTAAAAGAGAGATCTTTGGAGATAACACCAACATG...

CDS

Download CDS FASTA

1662 bp · TkA04G204340|TK1151|CDS

ATGGATGAGGGCGTCGTTCAAAAGAGGCTAAAAGAGAGATCTTTGGAGATAACACCAACATGGGCAGTGGCAGTGGTGGTGTTTGTGATACTCGCCATATCTATTGCTCTTGAGTACATCCTTCATCGCATAGGCCATTGGCTACATAATAATCACAAGAAAGCACTCAATGAAGCCCTTGAAAAGATCAAAGCAGAATTGATGATTCTAGGGTTCATATCACTGCTGCTAACAGTGGGTCAAGAACCAATCTCTGATAT...

Protein

Download Protein FASTA

553 aa · TkA04G204340|TK1151|PROTEIN

MDEGVVQKRLKERSLEITPTWAVAVVVFVILAISIALEYILHRIGHWLHNNHKKALNEALEKIKAELMILGFISLLLTVGQEPISDICIPSKVARTWHPCNNTKADNEYYDPCLKKGKVQMVSNYGIHQLHIFIFVLAVVHVLYCLLTLILGRLKMKKWRSWEDETKTVEYQYQHDPERFRFARETTFGRRHLRVWSNSTVLLWIGCFFRQFFASVPKVDYLTLRHGFINTHLPSESQQRFDFHKYISKSLEEDFKVVVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G204340`
TK1151 ID	TkA04G204340
OH-1004 ID	LXL04_034847
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G204340

Location Chr04:52497470-52505679 (-)

Description Similar to MLO12: MLO-like protein 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39200`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`At1g11310`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`At1g61560`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YD22`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`Os06g0486300`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034847 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009620 response to fungus Biological Process

GO:0010150 leaf senescence Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G11310

ath:AT1G61560

ath:AT2G39200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.839

Rank 1 · TkA04G204340 · TK1151

Cytoplasm0.114

Rank 2 · TkA04G204340 · TK1151

Endoplasmic reticulum0.095

Rank 3 · TkA04G204340 · TK1151

Lysosome / Vacuole0.045

Rank 4 · TkA04G204340 · TK1151

Golgi apparatus0.043

Rank 5 · TkA04G204340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03094Mlo12-107 aa

PF04306DUF45619-45 aa

PF03094Mlo108-466 aa

PF04306DUF456132-158 aa

PF04306DUF456258-313 aa

PF20990DUF2207_C264-319 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G204340	`PF03094`	Mlo	12	107	1e-218	727.3
TkA04G204340	`PF04306`	DUF456	19	45	8.7	7.0
TkA04G204340	`PF03094`	Mlo	108	466	1e-218	727.3
TkA04G204340	`PF04306`	DUF456	132	158	8.7	7.0
TkA04G204340	`PF04306`	DUF456	258	313	8.7	7.0
TkA04G204340	`PF20990`	DUF2207_C	264	319	9.4	6.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80961`	Arabidopsis thaliana	sp\|O80961\|MLO12_ARATH MLO-like protein 12	58.700%	Swiss-Prot	High
`Q9SXB6`	Arabidopsis thaliana	sp\|Q9SXB6\|MLO2_ARATH MLO-like protein 2	56.500%	Swiss-Prot	High
`Q94KB7`	Arabidopsis thaliana	sp\|Q94KB7\|MLO6_ARATH MLO-like protein 6	56.500%	Swiss-Prot	High
`A2YD22`	Oryza sativa subsp. indica	sp\|A2YD22\|MLOH1_ORYSI MLO protein homolog 1	48.200%	Swiss-Prot	Medium
`Q0DC45`	Oryza sativa subsp. japonica	sp\|Q0DC45\|MLOH1_ORYSJ MLO protein homolog 1	48.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card