TkA04G190030 | RubberDandelionOmics

Gene overview

TkA04G190030

Reference: TK1151 Chr: Chr04 Coordinates: 49006399-49011008 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2437 bp · TkA04G190030|TK1151|cDNA

GCTTTACCTATTGGAGATATAAAATTCGAGAAGGTAGTTCCGGGTATTCAGTTACTTTCCTTCAAGCTACCTACACCAGGGCAGCGTGTACTCACCATTACAGATAAGGATAAGAAGACCGGGATCTTAAATACTCCATTCCGATTTACCATCTTCATTGCATACTGTGATGGATTGAGGAGTATTGTTAATGGATCTGGATTACATAACTCCATTGCTGGAGAATCTTCAAAGTTTACTATCTTGTTAAGAGATGCTTA...

CDS

Download CDS FASTA

2352 bp · TkA04G190030|TK1151|CDS

GCTTTACCTATTGGAGATATAAAATTCGAGAAGGTAGTTCCGGGTATTCAGTTACTTTCCTTCAAGCTACCTACACCAGGGCAGCGTGTACTCACCATTACAGATAAGGATAAGAAGACCGGGATCTTAAATACTCCATTCCGATTTACCATCTTCATTGCATACTGTGATGGATTGAGGAGTATTGTTAATGGATCTGGATTACATAACTCCATTGCTGGAGAATCTTCAAAGTTTACTATCTTGTTAAGAGATGCTTA...

Protein

Download Protein FASTA

783 aa · TkA04G190030|TK1151|PROTEIN

ALPIGDIKFEKVVPGIQLLSFKLPTPGQRVLTITDKDKKTGILNTPFRFTIFIAYCDGLRSIVNGSGLHNSIAGESSKFTILLRDAYQYPSPLELHSLRVQITLPAQSLNVEAHIFPIDSINGTQNVGAFDPSVPSDYLQPDGFWKIWQSAYEVEYVAEKMGWYEISVFSGNVQLNDGKPFTKFVRGSGVVDISTSRVVKYEKAVINLVVQGVDIELKDAFHNPVVLPDSELSKLKLESKQWPLTTILWFKNEHGSYTCF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G190030`
TK1151 ID	TkA04G190030
OH-1004 ID	LXL04_029873
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 64.851 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G190030

Location Chr04:49006399-49011008 (-)

Description Similar to GEX2: Protein GAMETE EXPRESSED 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49150`	Protein GAMETE EXPRESSED 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029873 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0030036 actin cytoskeleton organization Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0061936 fusion of sperm to egg plasma membrane involved in double fertilization forming a zygote and endosperm Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0051015 actin filament binding Molecular Function

KEGG gene cross-reference

ath:AT5G49150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.461

Rank 1 · TkA04G190030 · TK1151

Cytoplasm0.244

Rank 2 · TkA04G190030 · TK1151

Lysosome / Vacuole0.154

Rank 3 · TkA04G190030 · TK1151

Endoplasmic reticulum0.150

Rank 4 · TkA04G190030 · TK1151

Golgi apparatus0.135

Rank 5 · TkA04G190030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00630Filamin58-176 aa

PF00630Filamin249-286 aa

PF17963Big_9297-370 aa

PF17803Cadherin_4298-379 aa

PF17892Cadherin_5334-374 aa

PF28974GEX2346-370 aa

PF28974GEX2408-508 aa

PF17963Big_9477-501 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G190030	`PF00630`	Filamin	58	176	8e-12	46.6
TkA04G190030	`PF00630`	Filamin	249	286	8e-12	46.6
TkA04G190030	`PF17963`	Big_9	297	370	1.4e-09	39.4
TkA04G190030	`PF17803`	Cadherin_4	298	379	2.5e-06	28.6
TkA04G190030	`PF17892`	Cadherin_5	334	374	2e-05	25.0
TkA04G190030	`PF28974`	GEX2	346	370	3.9e-42	142.9
TkA04G190030	`PF28974`	GEX2	408	508	3.9e-42	142.9
TkA04G190030	`PF17963`	Big_9	477	501	1.4e-09	39.4
TkA04G190030	`PF17803`	Cadherin_4	478	503	2.5e-06	28.6
TkA04G190030	`PF17803`	Cadherin_4	529	557	2.5e-06	28.6
TkA04G190030	`PF28974`	GEX2	600	645	3.9e-42	142.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K4R6`	Arabidopsis thaliana	sp\|F4K4R6\|GEX2_ARATH Protein GAMETE EXPRESSED 2	44.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card