TkA04G178610 | RubberDandelionOmics

Gene overview

TkA04G178610

Reference: TK1151 Chr: Chr04 Coordinates: 46228594-46231915 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2443 bp · TkA04G178610|TK1151|cDNA

AAACTATAAAAATAAAACCATGTAAAAAAAACCGGTTAAAAACCAGCTTTTGTGTGCTTCTAAGTTCTAACCCGAAACTAAACCCCGCTTTATCCCCCAAACCCCAAGCTTCGTACTAACACCATTCAGAGCTTAACGAGGGAGGAGGGGAGAGGATATGGCGGCAAGGGTGCAACACTCCCTTCAATTTCAAAGAAACAGCCTCAACACCTTCTTCTTCTCGTCGTCATCGTCTTCTTTTTCGAACTCGATCAACAAAA...

CDS

Download CDS FASTA

1881 bp · TkA04G178610|TK1151|CDS

ATGGCGGCAAGGGTGCAACACTCCCTTCAATTTCAAAGAAACAGCCTCAACACCTTCTTCTTCTCGTCGTCATCGTCTTCTTTTTCGAACTCGATCAACAAAACCCAATTCCGATACCGTTCAAAATGGTTCTCATCGTCTTCTTCTTCTTCTTCCAAAAGGCCAGGAGCCGCTTTATACTGCACTTGCAGTAGCAGTTCTAATTCTACCGATCTAAATTCAACAGCGATGCCGACAAAAGAAGACCCCTTTGTCCTGAC...

Protein

Download Protein FASTA

626 aa · TkA04G178610|TK1151|PROTEIN

MAARVQHSLQFQRNSLNTFFFSSSSSSFSNSINKTQFRYRSKWFSSSSSSSSKRPGAALYCTCSSSSNSTDLNSTAMPTKEDPFVLTTPLYYVNAPPHMGSAYSTIAADAIARFQRLTGKKVIFITGTDEHGEKIATAAAAGGSSPNDHCDTISQSYRALWKDLDISYDKFIRTTDSKHETIVEEFYSKVLSNGDIYRADYEGLYCVNCEEYKDEKELLEDNCCPMHLKPCVARKEDNYFFALSKYQKRLEVILEHNPDF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G178610`
TK1151 ID	TkA04G178610
OH-1004 ID	LXL04_035033
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G178610

Location Chr04:46228594-46231915 (-)

Description Similar to OVA1: Methionine--tRNA ligase, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55400`	Methionine--tRNA ligase, chloroplastic/mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035033 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006431 methionyl-tRNA aminoacylation Biological Process

GO:0048481 plant ovule development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004825 methionine-tRNA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

aae:aq_1257

ana:all0233

ath:AT3G55400

syn:slr0649

tel:tlr0750

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.827

Rank 1 · TkA04G178610 · TK1151

Mitochondrion0.241

Rank 2 · TkA04G178610 · TK1151

Cytoplasm0.069

Rank 3 · TkA04G178610 · TK1151

Nucleus0.034

Rank 4 · TkA04G178610 · TK1151

Peroxisome0.022

Rank 5 · TkA04G178610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00133tRNA-synt_179-295 aa

PF09334tRNA-synt_1g85-223 aa

PF01406tRNA-synt_1e96-252 aa

PF01751Toprim108-140 aa

PF09334tRNA-synt_1g217-443 aa

PF00133tRNA-synt_1301-409 aa

PF01406tRNA-synt_1e363-423 aa

PF19303Anticodon_3466-595 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G178610	`PF00133`	tRNA-synt_1	79	295	3.6e-26	92.6
TkA04G178610	`PF09334`	tRNA-synt_1g	85	223	1.5e-107	360.5
TkA04G178610	`PF01406`	tRNA-synt_1e	96	252	2.9e-14	53.9
TkA04G178610	`PF01751`	Toprim	108	140	0.16	12.9
TkA04G178610	`PF09334`	tRNA-synt_1g	217	443	1.5e-107	360.5
TkA04G178610	`PF00133`	tRNA-synt_1	301	409	3.6e-26	92.6
TkA04G178610	`PF01406`	tRNA-synt_1e	363	423	2.9e-14	53.9
TkA04G178610	`PF19303`	Anticodon_3	466	595	2.3e-09	38.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2T9`	Arabidopsis thaliana	sp\|Q9M2T9\|SYMM_ARATH Methionine--tRNA ligase, chloroplastic/mitochondrial	74.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card